Description :
From Genome Similarity Track
Location :
Scaffold_6:3206875- 3210830
Transcript NameFunction/comments
Phyin_T30-4PITG_04827Putative uncharacterized protein

Sequence
3955 bases(100 bases per row)
ACTAAACTCAGCTCACATTGAGCATTGCGGTAAGCCGCAGATTGCCGCCTTGTGTTGATCGAGGCACCCACAGTAGCAGTGAGCCACCGCCCGTACCAGG
GAGACCTAGGAAGCCCGGGCGCCAGCGGTCAAAAAACAACGTCTTGCCGCCCAAAACCGTCACATTTGATCTCCACGTCACAGTTTTACCCGCCGCGACG
GACACTTCATCGATCTTGTTACCTCCAGACTTGATATTCACAGTCACATCCTTTGTGTCGACACTCTTGAACGTAATGATGACAGAGCCGTCACCCTTCT
TCGTCCAGTTGCCAGCGCTGTTATTGAAAGCCGCCTTGACAGTCTTTAGACCCAGCGCGTCTTTCGCACTACCATCATCAATTTCACCGACATACTCTGT
AGGGCCACAGATGGTCTGGAAAAACTCGGAGATCGCTCCACCGATGTTCGTTTTGTCCCAAACAGCATAGAACGTTGCTGCCTTGTCAGCGATCTTGTAC
GCGTATTGTCCCGCAGTAAGAAGTGTGCCGTTACTACTCGTTCCTGAGCTGATCAAGTCGTCTACAATACCCCCAAATCCTTTGCGCAGAGTGTCCCGCG
TCGTATAGGCTGTGGCCTCGTCGGACTCGTCAAGTAGCTCCTGCATGCAGTTGTTCGTCACAGTCGGAATATCGTACAGCACGAGGTTCGACTTGCTCAT
AGCAACACGGATATCGTCCTCGGAGATTCTCGGGTTCTGTCGACGCAGTTCTGCTACGGTCATCCACGTTCGATCAAGCAATCGCTTCATGTCGTATCCG
CAGGTTGAGTCGGATTCCAGGGCCGACTCCAAAGACGTAATCTCCGACTTGTCCAGCGAATCGATCGTCTCGCCCAACGTGATATTCTTCATAAAATTTG
TGAATGCACTCCAACTGGAAACAATAAGGGCTCCGTTGGCAATAACATCTTTCACGACAAGCTCAATCGTGTTCACAAGTCTGTCCGAGAACTTGAATGC
ATCTTCTACTTTGATTCCCAGACACGACATAATTGTGATTGGAATGTCGAACACTACGTTGTCTGTCTGGTACAAGATCGTCAGCAACTGGTCTTGAGCA
GTCTGCGGGTCTGACACTTCGACGGCTCGCGTGTACTTGGACATCGCTTTCGCCAATCCCATCATCTCTTTGGCGCATTTGAATGCAATCTGCATGCCTT
TTGCCATTAACTTGAACTGTCCGTACACGTTATACGCAGCTAGGGAAAAGGCCGCCTGACCCACGGAAGAGACTTTGCTGATGATATCAAGTGCGCAGTC
GTCGTTTTGTCGGATGCACTCCATGCCACACTCGACGGGGTAAGCAAACGGACACTGCGCCCAGCACGTCCCAAGCTTGGCGTCGAATCCTTGCGGACAC
GTCTTGGCAATGTGAGCCTCACGATAGCATGCTGTGTCTTTTGCCGTGCCAAGAGCGGAGCCTACCCAGTTCTTGTAAGTGGACTTGATGGTGCTGGTGG
CGTTCAAGGCGTTGCTAAAAGAGAACGTGGCTAGAGAGGAATCACTGTCGTCATAGCTGTCTGAAGAATCGCTGTCGGTGGAGTTGTCGTCTAGGCTATC
CTCGGACTCATCGTCGCTGTCCTCATCATCATCGAAGGCTGACCTGAAGGTTATTTCTGCTCTGTTGGAGATTGTCCTGCTCTCGTTCGCCGTGAAGTTG
GCAGTGGTCACTGTTGCTGTTGGTACTGCTGATACATTTCTGCTAAATGTGAAGGATTGCGCACACGTAAGTGCACAAAAGACCAACGCAAGCGCGAGGG
TCAGTACCAGCAGTAGCCTGGTCATTCTTGTTAGCTTCGCAAAACGAAGAATGAATTGCCGTTAACGGGATTAACCGAGCCGCCGAAACTACAAGTCGTT
TGACGAGGCGCTCTTGCTGTGCAGGGCATGCGGTGACCGTCTCAATACTGCGCCAGATTCGTGTCGGTTGTGAACGCCATCGCCCAGACATAACGACATT
ATCACACTGGTTCCGTATCAAAATTAGATTCGAATCTTACTGTTCCGGCGCAACGGCGAATCTTGTGTTCGCAAACGGATCGACAACAAGGGACCTGACG
GACGTCGATGGGCGCTCTTGTGCCAGTCATTATTAGGATGATGGCCAACACGGTCGGCAACAGGTTGACAGTCAACCTGACTATAATACATGCACTCCTA
AACATGACCAGATGCCATCTCAATTTGTAGCAAAATATGGGACGAGGTTTGCTCGGGATTCAGTTGGCTAGCGCTAATGCTGCTAGAGAATCTGAGGCCA
CCAAATCTCATGACGTGGAGATATCAAAAGGATTGGTGCTACAGACCATAAATGAGCCTGGGCTCGAGACTCAGTCGGGGCGTACAAGTGTAACCTGTGT
AGCGAGGATTTGCAAAACTGCAGATTCGAGGTCGAAGGTGCCGAAATCGGATCTGGGTTGCTTGGTAGTTTTTGTGGGCTGGCCACCCTCAGGTGAGGCG
GTACAGTTTTAATTAGACCGTCTCAAAACTCATCAATCGTGGTTTACAATTCGGCGTTTGATCGGACAAACAGCGAATCTGAGCGGTCATTTAACGATCA
GTCTTCACGAAATCTTAGACTGCTGGCCTTTACAGCAATTTCTGGACCGCCGCCTTCCCTCCTGCTCAAAGCTATTCATTACTATGCATATAGGTCTGCA
CATAGTGGTGAAGAGATTTCTCTCTTCTTAAAAAAAAAAAGCTTTCAAAAAACTGTAGGTTAGCGCTTGAGTGTCAGCCATTATTATTTTAGACGAGGAA
AAACTTCTGCTCGGCAAGTAAAATGTCCAACCAGGTTTCATCTGCAGCATTGTCATCATCCAAACGTTGTTTTAGCTTTTGAAGCAACAGCCTTTCCCCT
CAGTGTGCGCAAAAATTCCCGTCGCGACTTCTCGTCGTTGTAGTGAATTGATCCTTCTTCATTTTCATTCTCTCCGGATGGATTGCTTTCATCTAAAGGC
CGATCATTTTCACCTGTGCGATCATTATCGTCTCGCTGCTCGTACGGAAGCGCACCGAGCTCATGAGCCAACAAGAAATTCCGAACCTCAGTTATCTGTT
CTCGCTCTCGTAGAAACCCTGCTGAATGAAGTCCTCGCTCAGAGCTACTTGCACACTCGAATGCACGCTGAAACTTCTCGGACGAGCGCGGTGTTGTCAA
TAGCGCATCTATTCCAGCAGGTTCCAGGCTCGCAGCTGCAATCGGATCCACTACAGTGATCACCGGTACGAGCGCAGTTTTGTGTGGAAAATATTTGCAA
TGTCCAGGAACATCAACTTGTACTCTCGATACTGTAACTTGACACCCGGAGCGTTGCAAATCCAGTTTTCGTGCTAGATATCCTGTGATCCTTGCACCAG
TCGTACAGTGCTTCAGAGCAACATCCAAGAAATCGTGCCACCGTGACCTACCAGCAATATAATAGCAGACCCCTCAGTGCCACATATCATCCCTACATCA
TATGCTTGTAGTCTGTCAACTCACCGCTGTCCACCGAGTACTCTATCAGGGCCTCCAAATTCAAGCTCTGGAAGCGGGTAATCGTCGAAGAAAACGCAGT
CAAACTGGCTCAGCATCGGGAGCTGCTGCTGCCACGTCCCAGCTACAATTTCAACTCCACTGTGGCTTATTGCAAACTGGCGAGCACGTTGCAGCGTCTC
CTCATCGCATTCGATGATGGTGTGGCTTTTGGGTCGGAACCGTTGGATGTGAGTCGCCGAATAAGCCAAACCGAAGCCGATTTCCAGTACACGGTCCGTC
GGCTGAATAGCGAGCCCTTCAACGCATAGCTCCATGTATTCCTTCTCCCACTGCATCATGACCTGCTGTCCGCGGGAGCTCCAGAGCACCTCATGGCCGA
GCTCGTCGAGTCCCTTGCTGTTGCCGTGCGTAGTCATCTTTTTGAAATCTCATTT