Description :
From Genome Similarity Track
Location :
scaffold_41:32068- 49225
Transcript NameFunction/comments
g1815.t1 ubiquitin-activating enzyme (E1), putative
g1816.t1 hypothetical protein PHYSODRAFT_554330
g1817.t1hypothetical protein
g1818.t1 actin-related protein 2/3 complex subunit, putative
g1819.t1 conserved hypothetical protein
g1820.t1 conserved hypothetical protein
g1821.t1 hypothetical protein PHYSODRAFT_470894
g1822.t1 conserved hypothetical protein
g1823.t1hypothetical protein

Sequence
17157 bases(100 bases per row)
ATCTGAGAACCCAATCACAGGCGACCAACAATTCAAAACGATGGTCAAGACGGTGGGCAGTGGGCAACTCGCGGCCGCGTTCGGCGTCGGTGTGGCGGCT
GCACTTGCGGCGCAATACGTGTACCAAATTGCATTAAAGCAGCGCAGTCTTGTGCCTAAGACCGCAGTGGCGACAACCCGCGGGACGGATGCTGCAGCTC
AGGAGCTGCTGGAAGAACAACTGTCCCGCATCTCCGCTTTCTTCGGCCCCGAGGGCTTCACTAATGTCAAAGACGCGTTCGTGGTGGTCGTAGGACTTGG
CGGTGTGGGCTCCCATGCTGCACACATGCTGGCGCGCTCGGGTGTTGGCAAGCTGAGGCTCGTGGACTTTGACAACGTGACGCTGTCGTCGCTTAACCGT
CACGCGGTGGCCACGCGCGCTGACGTGGGGCTCTCCAAGGTCGCGGCCATGAGGCGCCATCTGCACGAGATCGTACCGGACTGCGAGGTCGAAGATATGG
CCGTCATGTTCGAGGCTGATAGTGCCGACGAACTGCTAGAAGGAAACCCGACGTACGTTTTGGACTGTATTGACGACGTCAAGACCAAGTGCGCGCTTCT
GGAGGCTGCGACCCGCAAAGGACTCAAGGTTATCACGGCCACAGGAGCGGGTGCCAAGGCAGACCCCACACGCCTGCAGATCGGGTCGCTCAAGGACGCT
GTCCGTACGTGACTCGCTGTTCGGAAGTGTTTGATTAAGTGCTGATTGTTGTTTTTGATTTCGTGTTGTAGGTGACCCGTTAGCGACCAAGATCAGGTAC
TTCTTGAAGAAGAAGGGCGTGTTGTCGTCGGAGATTACAACCATCTTCTCGAGCGAGAAGAGCGTGTGCAAGTTGTTGCCTCTGGATGCCGAGCAGGCGC
AGAACCCGGAGGAGTTTGGCAACGTCGAGAACTTCCGTATCCGTGTGATCCCTGTGCTTGGAACGATGCCTGCGCTTTTCGGACAGTCCATGGCTGCGTA
TGTGCTGTGCGACTTGGCTGGCAAGAAGATCAACCCAGAGGCGGTCGCGCGGCTGTCCCGCGACCAGCGCAACAAGTTGTACCAGAAGCTGCAGCAGCGT
GAGCACGTGCTCTTCCACGAGGGCCACAAGATCGAGCTCGAGAAGGACGAGATCGAGTTCGTGTATCAGGAGATCTGGAGGGGGCGTAGTTCCGTAGGCG
AATCCCGCAACGGTGGTCACGATCGACTGTACCTGGCGCGTTGGCGGACGGACCGTCCACTGCACCCTGACAACGTGGTGTACCTAACGACAAAGGAACT
CGCCACCCTGGACAAAAGCGGCATCGAAGGCTTCGACCCTGACGTTGTTGCTCGCATTGATGCTCGTCTAAGTCAGTTCGGCAGCTGGACTGTTCCTCAG
TAGAAAAGCAGATTTTGAAAGACACCAAGCAATAGGTGACTAGACTTGGTCGAAAATGGACATTTTGCAGTAATGCAGATCATGCGACATGTGAACATAT
CTTGCTTTTTGTATGGTCTCAGCCGTTATCCAATTCTACAGTACGCTCCATGCCACCTCAGTCATAGGTATCTGCTTCAGTTAGCAATCCCCCTCGACGA
CCAGCAGTCCCAGCACTTCCTCATCCATCATGGCCACCTCGAAGAAAGTGACGCAGCGACTCACCCGCGAGTCCTTTAAGCAGTGGATCCAGGGCCTCGA
CGCCTTCCTCTTCGACTGCGATGGAGGTGCGTGCAATTGGAGAAGACTTTTACGTATTTTGACACGAATGAAAATCTGAATCTGGTTGATACTCGACAGT
GTTGTGGCGTGGAGCTGCCCCTATCGAGGGAGCTGCCAACATGATCAGCCTCCTGCGTTCGCTCAACAAGCGCGTAGTGTTTGTGGTACGTTGTATGAAG
CTGTTGAGGGGTGAGAGTAGTGGAGACTCTTAACGTTTCGTGCTGTGCAGACCAACAACGCCACCAACAGCAGAGCCACCTACGTGAAGAAGCTTGGTAC
GTACAACGGTAGTGGATTTAAGCAGGGCGGTTTAAACTGATGGTGGATGTTTGGTTGTGCTACAGCTTCTCAGGGCATCACCGCTGTCGAGGCTGACATC
GTGACGTAAGACGTGCTTTGCTTTAGTCTTGCTTACGCTTACTGAGCTAACGGAGTGGTTAATGTTCTCTATTGCACTTCAGTTCGGCGTGGGCAACGGT
GCAGTACATGAAGCAGCACAAGATTGAGGGAAAGGTGTACATGGTGGGCGAGGCTGGTCTCCAGACGGAGCTGGAGCTGGAGGGATACCAGGTCAGCGGA
ATGGAGCACAGCGACATCAAGGGCCTCCCACACGTGCCTGATATCGATATGGAAACGAAGGCAGTCGTCTGCGGTCTCGACAGGTAGAAAAGCTAGAGAT
CTTGTCCTCTTCGAGCGAAACCATTAACTGTTCTTTCGGCGCAGATACTTCTCGTACTACAAGATGGCGTACGCAACGGCTTGTGTGCGTCAGATCCCCG
GCTGCCGCTTCATTGGAACTAACCCGTAAGTTTGTGCTCACGTGGATATATCATTTGGTCATCTTTTCATTGACGGCACTTTTAATATTTTCGTTCAGTG
ACTCGACGTTCCCGACAGATGGCGCCATTATCCCCGGTGGAGGCTCTCTGGTTCACATGCTGGAGTGCGCTGTTGGCCAGTACGTGTTAGCTCTCAGTAT
CGTTTGGAATGCTTTGTACTGATAAATTTTGTATTATTTGATCCTATGCAGCCCTCCTGAAGCCGTGTGTGGTAAGCCGTCACAGGATCTGCTTCAGACG
ATCATTGCCACGTACAACCTGGACCCTTCGCGCACGTGCATGGTACAAGATCTGCTATTAAGCTTACAGCATTTTCAGTGATCAAAAGGCTAATACTTGT
TGTACTTTGTTAGGTGGGAGACCGTCTTTCGACTGACATTGAGTTCGGCAATGGCGGCGGGTTGAGTACACTGCTGGTGCTGACGGGAATCACGCTCGAG
TCGGAGCTGAGCAGCATCGACAATGCTCTTCACGTACCTGACCACTACGTCGACTCAGTCGATGTGATTAACCAGCTTCATGCTGAGACGCTTGACAACT
GAAGTTGCTGGCCTCCCAATGTAGCCACGCATCTGGTTAAGTAGCCTTTGTAGGACATGACGTTATTGCAGCTTAGCGACCGTGACCCAATTCAATAGAG
CCGACATGAACATGCGCGTTTCATAGTTTGTTCGGATGGCAAAATCACGCCACGTAGTATATTACACTATGGACACCAATTCAAAAGCTAAACTGACGGC
GATACGTCTCCCGAATTTTTCACTTTCAGCCTAGGAATCGCCCCGCCACTTCCACTGTTCACGAAAGCGTCAAACATCGAGAAGCCACCACCGTTTGAAG
CAGTACTGCCACCACCGCCAAATCTGTTCGCACTGGTTGTCGTTTTCTTTGGTCGGACAGGGGCGGAATTCAGTCGACGGGTAGTAGTTGTGCTGCGAAC
ACTTGTTGGGCGAGGTCCTGGTGATGCCGCCTTCGGCTTGATTCCGACCATGGGAGACATCAGAGGAGTTGGAGTCCGCAAGTATCGTGGCATCGGCGAC
TTTGCCAAACGCTTCGTGATTTCCAAAAACTGCAACTTCTTTGCGGGTGTCACATCTGTATCTGCCGTCCCTCTTGGCCTCTTTCGTGTTGGAGCTCGTA
AATTCCCCGGAGATTCATCGTCGCTGATTAACCCGCTGCTATTTAAGCTGATATTTAAATCTCCGTCCTCCATCATTTGGTCGCGTTGTGATACGTCTGG
CTCTGCTGCATCGGTCGCCACGTCCTTCCTGAATTCTGCCCGCTTCGCCGCCAACATATCTGCCTCTTGAGTCTTCTTTGACTTCTTGCCCAGCACCTTT
GGAGTGCTGATGTCTTGCATCTTGTTTATCCGAGCAAGTAGTTCAGCATTCGCTAATCGTTGCTTGATCGACATTGGCTCACTTCTGCTACCAACTTTCT
TCTTTGTTGGCGCGGCAGTCGAATTCCCCTCGGCTTCAGCTGAAGCCTTCCCATTTTTTATCTGGGGCTTGGCTTTAGTTCGCGGATTCTTTTTCTCCAC
AGCAGTACTGCTTGTTGATTTGTCGGCTATTGAGTTCCCAGCCCCCTTCTTCGTTTTAACTGGGATTGCAGTGTTCGCCATAGTCGCCATCAAACTTTTC
CCTCCTAAGGTAGCAGCACGGCTTGCCTTCTGGTCTTTTCGCCGTTTTAAACGCTTCCGTGGGGTAGCCGTTGACGGCACTGGCTCAGGTTCAGAGTCTG
CACCTTCGCTCTCCTCCTGCTCAGCAGCGTCCACCTCCGCCTTAGCCTGCCGCCTCGCCTCCGCATTCGTAAAGTTGAAATCAATTGATGGTCCCTTTTT
CTTCGCGAACCGCTTCCGCGGCGTCAGCTTTTTCTTCTTCAACGGTGACGGTTGACGTTTCGGAGAGTCTTCAGTGACCGGCAAAATCAAACTCACCATA
GACGGCTCGTCATCGGCATCCGAATCACTGTCCTTATCCAGCGACAACATCAGCAGCCCGTCATCCGGTAGTTCAGGAGGTGGACTTTCATATCCACCAA
GTGCATCCTGATTCTCCTCCGAAACTGAGTCGTCTTCAGGCTGCGCTGACGGCAAATTTATAGGCGTAATTCTCTTTGGAACCGCAGCTTTTGTCGTCTG
GCTCTTTTTAATCTGCTTCTTGGCCTTCACCACCGTTGGCTTCACTTTTGTGACCTCCTTCCTGTTAGACACAGATTCCTCAGCCGTTTTAATGCCATCG
GCCACTTGCTTCAGCTTCTTCTTCATCTTTGCTTCCTGTTCCTTGTACAGCGCTGCCTTCCTTTCTTGTTCCCTGTATTGAGCTTCTTTTTCCTCTTGTT
GACGACGCAAAGCCTCCTCCTTCTCTCGATCCTGCTTCTGCTGCTCCTGGCGCTGGAGTCTGCGCATCTGCTGCTTGTACTGCAGTTCCTCCTTCTCCAT
ATTTTCCATTAGAAGGAACTGCTGCCATGTTTTCTGCAGTCGCTGGCGCCGTAGCTCGATAGACTCCCACTATACACATGACGAGCGTCGCAGCGATTCG
TTAGCATGTATAAAACTCGCGTTGTAGACACATTCACCACGTACTTCCAAGTTAAACGCCTCCAGTAAAATCTCTTCCGGGTACGGATCCCCGGTATGGG
TCAAGGCGCTGTCTGGGGACTCCATACGGCCCTCAAGTCGACAAGCCCCTCGGGCACGTCGAGGGTAGTCGGATTTCCTCGCGCGCTGGGCGATTCAAAT
TCCAAATGTTCGTTGAGGTGGTGCACATTGCAATAGTGTGCGTCACACTAAGGTTGAAGCAGTCCTTGTAGAGAGAGTTCCGGAGACATTTCTCTCTTTA
GAAGAACTGCACCATAATCCTCCTTTTGGAAGCAGATCAAAGGGAGTCAGACTTGATACAAACAGCAAGACAACACTATGGCAGCAGGGGGCGACGCGAA
TCTCTTCCAACTGGCGGACGGCATCTCGTGCCACGCGTGGAACAAGGACCGCTCGAAGCTGGCTATTTGCCCCAACTCCAACGAGATCTGGATCTACTCG
GGCTGCCACGCTGCGGATCCGAAGCAATGGCGCAAGGAGGCGGTTCTCACGGAGCACGACATGCTCGTGAGCGGCTTGGACTGGTCTCCGGTGCACGACC
AACTCGTGTCCTGCTCGCACGACCGCAGCGCCTTCGTGTGGAAGTATGAGGCTGCCTACCGCCAGTGGAAGCCGCTGCTTGTGGTGCTGCGTATCACGCG
TGCCGCTACGAACGTGAAATGGAGCCCTGATGGTAAAGAATGGCAACATTGCAATTTGAAGTGAATTAATTGCTAATTTTAAATGATAATTGTGTGCAGG
CAAGAAGTTCGCGGTGAGCAGTGGAGCCAAGTGTGTGTCTGTGTGCTACTACCAGGCGTCGGAGAACTGGTGGGTCAGCAAGATCATCAAGAAACACAAG
TCCACGTACGTAGCTTCAACTTGGTGTGTTTGAAGAGATATTGAGCTGATTGGTGTATTTATTGCAGGGTCACGGACTTGGACTGGCACCCGAACAGCCA
GTTGCTGGTAACTGGAAGCACGGACCTCAAGTGCCGCGTTTTCTCGGCGCACATCAACGACGTCGATGGATCGTCGGATGCTGGTCCGTTTCAAGCCTTG
CCTCCGTTTGGTGAACCTCTTGCGGAATTCGACAATGCCAATGCTTGGGTAAACGCTGTCGCGTGGTCTCCCAAGGGCAACCGCTTGGCGTTTGCCGGCC
AGGGATCGTCCATTCACATTGTTCACTTTGGTGCTCCTGGTGAATATCCTACGATTCAGGTAACGTCAGGATCTTGTGGAACGTTGTGCACTTGAGTTTG
TTGTACTGAGGAAACAATTGTGATGCAGTCGATCCGATTCCCGCACCTGCCTCTGATGCGCATTATGTTCCTGTCGAATTCTGCGATTGTCGGTGTGGGT
TACGATTTCAATCCTCTGCTGTTCTCCCAGGACGGCAACAACTTCTGGTAAGGATGTTTTGATTGTGAATGCATGTATTGTGGAAGTAGGCTGACTGAGT
TTATTTGCTTAGGTCGTTCTCTGAGTTTGTTGACAAGAAACCGACTGAGAGCGCTGTGAAGAGAAACGCTGGTGGCTTCAACGCTGGTACGATCTTGACT
CACCGGATGTTTGAGAGTTGGCTGTTAACTGATCTTTTTTCTCGTGCGTCTGATGAATGACAGCTCGTAGCCTGTTTGAGAGCAAGGTGACGCGTGGCCA
ATCTTCTGATGCTACTCAGCACGACAAGAATATGCTGTGGATGTACGTTAGATTTGTGTCGTGCAGGTATTGTTGCGTTTTGGAGACTAAACTGCTTCTT
TGCAGGAAACACGAGAGTAACATCACATGCATCCAGCCCTACGTGAAGTCTGCCTCTGGAAGTGTCACGGAATTCTCCACGTCGGGTACGCTAGAACGAA
AGCTGACTGACTTGTGACGTTATGCTGAATGCGCTAATTCTGTTTGGCTGTTTTCACTTATAGCACTTGATGGCCGTATTGCCCTGTGGAAGCTGGGAAG
TTTGAACGTGGAATTGAGCAAGCTTCATCTGTAAAAGGATAACCTGCCTCTTACTTTGGCAACGGCAAGGTAAAAGATCTTTACAATTTTACCTGTAGAC
TCAAGTGCAGCAAAACAAGCACCTCTGTTGATGCACTAGCAAGACGTTCATTATGCCACAGAGACAGAGTAGTCGGTCAACTTGGTATGCTCTTTCGAAT
TACAACCGGGGCCACAATTCTATTCGTACACCCGCTTTAGCCGTCTATACTCCTGCCGATACTGATTCTCAACTACAGAGGCTTGGCGAAAGTCTTTCCA
CTCTGGAAATTCCGTGAGCAGCACCTTCGGGTCGTACGAAAGCAGCAACTGGATGCCCTGGCTAACGTCATTCAGCGTACGCGCGAGATCAATGTGGTCT
GGGTTCAGGTACATCCGCTGAAGCTCCAGCAGCTCGTAACTGCTGCGCAAGAACAGGATCGAGTACTCGCAGACACGCTCGGTTTTCCCACGCAGCAGCA
GATCACATGAGTCAGCTACCAGCTTGTGGATGCGCATAAATACCAAGTGGTCGTGGGCCACGATCTCCAGAGCGTCAGACAGCGTCTCCAACGCCACAGA
GAGCGCATCGGCAGCGCTTTCGGGGTTCGTTTTGATGATCTCTTCCGCTCCAACCAGCACCTTCTCTAAGTCCGGCATTTCAGGTTTCGTTCCGTCGCTG
TCATTCGTTGCACTCGGAGGCGGAGGCAGCACACTGTCGCCGCGCTTACAGAGCGCACAGCTGCACTCAAAGCCAAACTGCTCCCACAGATTCTTCTGTC
TGTTCTCTTGACTCTGCTCGCGCGGGTACAAGTACGAGATCGTAAGCTGCTCCCCCTTGGCAATCGGTCGCGCAACTCGCACCTCCGACACGCCGCCTCC
CGGCCCAGCATCCTCCGGTGTAAACTTGACGCAGTTTGGATTGCATTCGTGGTTGAACATAGCATTGTACAGGAACACACCGCTGTCGAAAGCGTTGCAC
TGCATGGCGAACACATTCTGCAGCACCTGGTCGTGCGACAACGCCAGCTCACTGAAGTTCTTGCACAGTTCGTCTACTTGCGGGCCGTACTTCTCCCTTC
CTGCAGCCAGCAACGCATCAGGCAGCTCGCTAAGCTTTTCAGGGAACAAGTGTCCAAGATGATCCATTATGTCGGCGTAGTCTGGTCGAGACAGCACCGA
CTCCATCGTGGCTAGGAAGAATTCCGGGTCCGATGTCTCCACGTCACTTGGCCAAGGCACATACACCTGTTCCACCAGGACTTGAGTACCTGGCTTCAGG
TCTCTCGTAGCTACGTACCCACGGGATCCTCCAACGCCATTGAAGCTCGTCACCAGGTCTATGGGCCCCACCGTCAGTGGTTTAACGTCATCCCAAGGCT
TGTACAGACTTCTGGTCACAGGACTCGCGTCTTTCTCCTCTTCTGTAACAGGAAAGTCCGTAGCAGCAGCAGGAGCAATGTGCATAACCTCATGCGGTGT
CACCAGCGTCTCGTTGTCGCTGCTGTCGTCGTCGAAGAGGCCGAACGCCGCCTGCACGGACGCACTGGGCTTGCCACTCATGCTGGTTGGCCTGCAATTG
ACATCATGCAAACGTAGGTGATCGCTGATTGGCTAGCATTTTATTTACCTAAACCAAGTTTAAAACTCATTTGACTTTAGGTCATTAACAATTCACTAAA
GTTCGAAATACGAGAAGGAGAATTCCCTCTTTACACAAACCAAGTCACAAAAGAAAATACCGACCCCTCCCTTTTGTGGTTCATCATGGCGGAAGACTTG
GGCGCTATCTTGACGGATGCCGGGCGGAATTTCGTCCCGGAATCTGCTGCAGTACCGCAGAGTGATGGTCTTGCGCGTGCAGCGGCTTCTGGTGCGTCCG
GCCTGCCACTTGGGCGTCGCATGCGGCTGACGCTCGGCCAGAAGCGCGAGGTGGTGGACCTGGCAGCCAGCAAGAAGTTCACACACCGAGAGCTGGCCGA
GAAGTTCCGCGTGGGGCGCACCACCATCACCAACATCTGCAGACAAGAGGATCTTATACGCACGGAAACCGACTCGGCCGACGCTACGAAGAAGAAGAGG
AAGACCACGAGGTGCACGTACGATTTGCGGGTGTTGGACGAGTGTCTGCACAAGTGGCGGATGGAGGTGAAAGTCTCCAGTCCTGATACCAAGCTCACTG
GCACAGTGCTGCAGCATAAAGCCATGGAGCTGGCCTGTAAAATCGTGCAGGAGCCCTATGCGGCGTTGCCTGATAAGGTGAAGCAGGCGTTGCAGAAGTT
TACAGGCTCCAATGGCTGGTTGGATGGATACAGAACCAGATTCGGCTCGTTCAGCAGTAAGCAGATCCCAGGTGGAGGAGACCAGAGTGTGATCAAGAGT
GTGGACGTTCAGACGAGGCTGAGAGAGCTCCATTATGCCTTCACTAATGTGGAGCTGGAGGATATTTGGACGGGAGGGGAGTTTGCAGTCACGTACAAAC
CGCCTGTACCCGATACAGTCAATGGAACTGGGAACAACAGATACACGGTCTCGCTGTTCGTAAGCGCGGCTGGAGAGAAGCACGACTTGCAAGTCATTGG
CACGGACAGAAACCCACTGCTGCTGGAGAAAATTGACACCAAGGAGATGTACAATATTCAGTATGGATACTCGAAAACGGGCTGGCAGGTGGCACAGACG
ACCGTGAGCATGCTGAAGTCACTGAACGCAGTTGCGAAGGAACGCAAGCGCACGTTCCGAGTGGTTTTGGACTCGGCCGTGCCCCACGTTAAAGCTGCTA
TGATCTTGGACTCGCAGGGAGATCAGCGCACCTTTTTCGTGTACGACCATATTCAGATTTATTTCCTGCCGCCGAACTTTAAGGTCCCACGATTCCACCC
GTGCCACCTTGGCATTATCCAAGCTTTCAAAGCGCGCTTCCGCAGCGAGATGCTCGAGACGCTGTTCAACAATTACCGGCAGAGCGTGATGAACCAAGAC
CCTCGTGGCTTCCACCCACAACGGCACTTGCACACGCGCAACGTTTTCCACTGGTTTTACGTGGCTCTTCACAGCCTTGACAAGCACCTCATCCAGACTT
GCTGGGTACAGAGCGGGTTATTACCCACGCAGTCTATTGCATCTCTCAACTTGCGCGTCATTTTAGGCAACGGCGCAGCGACAAGCGGGGACGATAGTAG
TGGTGCGAATTCTGATGTCGGGGTCAATGGTTCAAACGAAACAACAAGCTCATCGTTGGGAGTCAATGGGGGTATACTGTCCCCAACGCTGCTGTATCGA
GAGCTACAGCAGCAGCTAACAAGTATCGTCCAGGTCGCTCCTGACTTCCTGCGGTGGATTGGGGTAACCGACCCCACCAACGCCCAGGCATTTGTAGAGC
TCGAAGGCAACGCCTCCGTGACCGACCCAGGGATCGATGAGGTCCAGATCATCCGCAGTGTGCTCCAAAAGCACGGATACTTGTCAACAAAACGGCTTGA
CGACGAAAGTCACGCGGCAGGCGCTTACGAGACGTTTGAAGACGTGGCTGATGAACTCTGCCCGCGACCCGAAGAAGTTCTCGCTTCGATCGGTATTCTC
AAGAGGTATCTGCGTTTGTCACGAGACCCGATCCCAAGCCGTGTTGATGCTGTTGTGCAGTTGAACAAAGTGAAGAAAGCTGTCGAGACCGCCGGATTTC
GTAACGCTGCAATTTGAGTGAAAGCTTGCTGTCTTGTAGGTTTACAGTTCATGATACTACGTTCATGGATTCACTGCTGTTGCCTTATATCTTTTATCTT
ACACATTGTCACTTGGTCTAACAGAAAGCGTCTTTTCTTGCATCGTTGAGCTAGTACACGGTCCGGATTTTATAGTTGGGAGACATGGCCGCCATCATGG
GAGCATCGTCAAGCCGTCGATTTGGCTGGTTTGCTATTGGAGACGGCGTTCTTGCGGTTCGGGCGGTGGAAGACGACGGGCGTGGCAACTGATCGTCTTC
TAAGGGCAGAATTGTTCGTTCAGCGATGGCTTGATGCTCGATGCGGCGCTGACGTCGTGCGTAGGCGACCAGTGTTCGAAGGGCACTGACCAGCCAGTCG
CGATGGCTTGAGCTCTGGGTCTCCAGGTCTAACGTGCGTCCTCGGAACACAACCGAGAATGAGCATGCCTCGAGCACACCGGTAGACGTGTACTTGCGAA
ACACTGCTGTCTGTCTTCCGTCCAGCACCTGAAGCACTTCCGCCAAATCTACCGCTTCACTAAGACCGCCTCGTTTGTGCTGCCACTGCAGCGTTCCGCA
GCAATTGCAGTGTAGTCGAGTTGCATGAGCTCCTCCACGGCGGCCGTATTTGAGCAAAGGGAAGAACATGTTGATCGCCTGTACTAGATATGACCGGTGC
TTGCCGCCGAAGCGGAAAGCCAACTCCACAATTTTCCATCGAGCTCCTTCGATCGTCTCCAGCTCTTCGTCTGTGAACAGGTAGGTTTTACGCTTCTTGC
GCAAATGAAGCGTCTCCAGGACACGTGGACCGATCCTCGAGAACGCGCTCTTCTTGTGTTTCTTGGCCGGATGCATCTCCTGCGGGAGGAGTGTGGGGCT
TATCGGTGGTGGGGTAGGCATTGAAGGCTCATCCATTGGAGACGGGATGCCAAGGTCGTACGCACTCGGACAAGACCCAGCTCTCCTTCGAGTAGGAGGC
GCCTTAGACTTGAGGCGGATCCCGTGGGATTGAGACATGGGTTTGTTAATCTGCTCCGAGTCGTCCTGCAGCTCGATCACCAGCCGTCTTACACTCGATG
TAAGTTGGTCCTGCGCGGACAACGCGGCTTGTTCATGAGCACAGCTCAGCAGGCGAGTTCGATGCCGCTGCAGTAACCTGTGCTCAGCGGGGCTCAGCTC
TTGCGCATGAATCAAGGCCTCTTCTTCCTCGCTACTGGATCTTTCCTGGTCGATGAAAGTGTCGTTGTCCAGATCCAGATCCTCCACATCGTCAACACCT
TCGTCAGATTCTTCGTCCTCGTCGTCGTCTTGGTTAGATGCATCGGCAGCGTTCAACGCAGGAACGTCCGTCTCTCCCAGCAGGCTTTCACTCTTGATCC
GGCTCACCAACGTGCGCACACTCGTGGAAATGTTCACATGGCCGAAATCCAGCAAGTCTCCATTGTCTTCCACGCTTTTGCCATCGACTGCAGCGTCCTC
CTCAGTACAATGTGCACCGCGACGCTCTTCCTCCTCGAGGTTCTCCTGCTCGTTGTTATCCATCTCTTCTTCAATCCGTTCCACCTCCGGTTTCTCTTCC
AGGACGTCCGGTAACATCGTGGGCGGTGCAAAGCTCGCGTGCATTTCACCGAACTCCCCCATCTGTGCCTCGAGCGTCGCTCTCCGCATCAGTTCCGCGT
GGCTCAATGGCTTTGCCAAGGCCGCCGCCACTAGAGGTCGGGCCGGATAAAACTGGAGCCGTTGGTTTGCACCTCGACCGTTGGTGCTGTCACTAGGGTC
CCACATGGTCATATTGGACTGCATCGTAGGCGTCGAGCCGACGCTACTGCGTCGCGGATGCCGAGCTTTAGCCGGCCGAGGTTTGTCGTCGTCGCTCTCC
TTGTCCAGGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGAGGCTGCTGCGGCTGTTGCTGTTGCTGTTGCTATTGCTGCTGCTACTACCTCGTATGTCCT
CCGGGTCCACCTGGAACAAGCTGCCGCGCCGCACAATAGCCGACAGCTTGCCCAGCAGCACTACGCTGGATGAGCGTTCGCGCCGCGGACGACCGCCCGA
CCACGGCTGCATGTGTACAGAGCAGGAATTGGGAAAATCCACACGGAAGAGTGGGAGGGATCTCTCCGGACTTGTGGCCCAACGCGAAATGAGCGCGAAC
TCGACCACCTGAGAGCGAGAAGCTGGCGAGGAATGAGAAAACCGTCGGACACTTGCAAGTGGCCGGACAGGACTTCCGCTTCTGGACGCGATGACCAGAG
TGGTTGTGGCCGCTGACTACCGTGGGCTTCTGTTTTTGGCCGTTGGCACAAGTGTCTTCAATGTGGCCAATGTAGCCATGCTGGCTTCTACGGGGTATCG
GGTCTGAAAAGTTCAAATCTAACAGTCAACCTGATGTTTTCGTCTTGCGCCGAGTCAAACGACATTGACTTTGCCAGGTAGTGATGCCCAAGTGTCCGAG
AGCCGTTATCGGTATCGGTTGCCACCGGTCCGCTGCTGGAACGTTCAGCGTTCAGATGCTCAAGTCGGAGGTCATCGCCAGCCACTGGGCCTCTTCTAGG
TTCCAGATTCCACGGGCTCCGTTGCTCTCCATCTCCTTCTTCGTCATTTGTTGCCTGGCCTTTCGCCGCACCTCAATGCAACCAACTACAGCGGATGGCC
ACGACCACAGCTTTCAGCCGGACATGCTGCATGATGCTACGGGGTTTGCTGGACTCCCCAAGCCGCACCACTTGGGGGAACTTGCTACAACTTGCCTCAA
TCCTCTGAAATGACGTACGAATGGTACACTGTACCAACCCCCGATAAAGCTCGAAAGTTCGTAACAGCAACTGTAGCCGACTAAAATTATGGTGAGTGGT
GGCAAAACTCCTCGCCGCAATGCTGCGCAGCGTCGCGCGCGGCTACAAGGCACCAGCGCGCTACTGCAGAGCAGTCCAGATACGGCGCACCCTTCGTCTC
GTCTTCTGGTGTGGCACTCGCGCTTCTCCCACGCTCCATCTCGCCATGAAAGCATCATCAACGGACACGCTTTCAACCAGCAGCTAGAGGTTTATCTTCC
GTCGAAAGCTGGGAAGGCTACAGCGCAGTCACTCCAATGGGAAACAGGATTTTACTACGAGATTAAGGCATCTTTAGACATGTTCCTGTCGCCTACATTC
ATCCGAGAGTATCTGACAGATGGCGGCACAGTCTTTATGGTGGCCAAGAATGCTGCAGTGGACGCTTCGCAGTCGGCGATGCTGCTGCCTTCGGGTCAGT
TGCTGCTACTGGTGGATGCCGACACATACCAGCAGTTGGGGGTTGTCGGAGAGAAATATGGCAAGGCAGTGCCTGCTACGAGCAGGTCGGCACACTCGAA
GCGTGCTCAGAAGTACGTGATCACACTGGACCTGACGTCGCCCACATTCACTGAAGGAGAAAACGCCTTCAGAGATCGAGTTAGACAGTGCTTGAGTACC
AAGCTAGAGGACCTGGAGATGCTGCTGTGCGCGTACAACCAGCGCGGATCTGCACGCACGATCCTGTTTGGAGATGACGACCAGATTCCGCGTTCGCGTA
TTGAGCTGAATGCCAAGATGACGACGTTCACCGACGTATTTCTGCCAAAGTTCGACGCGTTTTACAAGCAGCTAGCCGCGAACGAAGAGCATGGAGACGA
GGAAGGAGATACACTGAGGACGTCGCTGCAAGAAGCGTACGAATGGCTGGGAATTGTGGCTTGTGGCTTAGTCGACTTGCTGCAGAGACAGAAGCAGGAA
GAGTATGTGTCGACGTTCACGGGGATCCCCGACTTGTTCGAGTGTGATCCGAACAGTGAGATCACGACTGTGCGGTGGCGAGGTTTAGTTGCTTCTCCCT
TTTGCTCGACGATTGTGAGCAAGGTGCAGCGTGCGGTTAAGAGTGGGGAGGTACCTTGGGGTGCAGTGACGGTCTGGGGCTTGCCGGACGTCTTCGTATC
GTGGGTGCAACCCAAGGCGAGCAAAAGCAGGAACGGAACACGTGAGTCGCAGGCGCGAGAACATGGATACGTGGGTAATGGCAGCAACAACTATACTCTG
CTCATTCTCCCGGACGACGAGTACTTCCTGTTGCAAGCTCTTGGTCCGCATGATGCCACAGTGTAGACGTAACGAACACAATATAACATCGCAACAGTAT
CCAAGTTACCGTTATCGATGTAGAACACGAGGGTTAGTTCACCAGGACGTTCTCGACGAATGCTGCAACCGTTGATGAGTTCGAGGCCGACGTCGCTTCG
GCCAGCGTAACAGCAACCTTGATGTGCTTCCGGGCAGGCTTCACGTTGTTCTTCTTGCCATGGATGAGTGCCAGCCGCAAGTTTGCCAAGAAGCAGGCAG
CAGCATCGCTGGAAGTGCTTAAGGCGGTGGTAGTACTGCTCATATCGTCATCGCCTTCTGTGGATCCGACGGACTTAATCGCTGTTAGCGAAGCAACAAG
CTTCCACACCGTGATAGCAGCATCCAAGAGCTGAAGCTCCTCATAAACTCCACCAAGCTCAATTAGAATCGGAACAAGTCGACTTGAAGGCACAGCAGCA
TCTGAGACAGCAGAAATGACACTCAGATACTTTTCGACGGCCTTTGCTGGGCTTGACATCATGAGCAATCGAGCTTCTAACAGATCGGTGTCCACGGAGG
GCGTCAGGGTGCCATTTTTCTTGCCTGCTTCCACTCGGCTCAATGCCTGACCAGAGATGGCAACCGCCTGATCCAGCTCACCCAGCTTGATGTAGCAGTA
GCTGCTTAGTAATTCCAACTGAGTTGCGTCGTACTCCTTTCCGGCAGCAACAGCTAGTGCCAATCCGGTCTGCAGCAAGCGAATTAGTTGACGAAGAAGC
TCATCTTGTGTCTCTTGTTTCGCTTCAAAATTCATCCGCTTGAGAACGCTTGCTCCAGTCAGAACGTAAGCCCGCGGATTCCAAGGTTGAGCACGAATCA
ACTTTTGCGCATTCAAGCACAGCCCCTTTGCTCCGGTCGAATTAGCCTTGAATAACCCCAGCAGCGCATCGAGGAGATTGCGATCCGCTGTGTCATTTCC
AGGCGATGATATCTCGCTGGCAGCCGAACGCATGTACTCCGCGAGGCAACTGGACACCTGGAGATTTTGCGAATCGATCGTTGCGAGGGCTAACCGCATC
CATAACGTACTGGAGTTGGCGCCATCAGTAGCTTGCGACAGCGCTTGTAAGCGTGTCAAATAAGCATCATCATCGCCCATCCGGCGTTCATGAAGCTCGA
CCACCCGCAGATCCAGGTAATCGCGAGTAGTGAAAGTTGACCCCGCTTGATCAATTGCAGCCAACAGGCGCTCCTTACACATAGCAGCAACACGGGTTGC
CTTCGAATTGAATCCGTCCATTAACAAGCTTGCCAACGAAAGACCAACAAGAGCAACGAGTTCGGTTTGAGTAGACTGGGAATCGTCTTGCAGCAGCAGA
GTCTGAAGTAGATCCAGCGCCTCGCCTCCCTTCGACTCGCGATACAAAATCTGCGCTTTCACAATGGTTTTTACTGCTGCGAACTTACTTGTCGACGGGT
CAATCTGGGCGAGCTTTCCCAAAAGTGCTGCCTCATTCGCCTTAGCGTCTTGAGACTTGGTGGACAACTCACCAAGTTTTGTCACCAGAGTGTTCCATTC
AAGGCTCTCAGATGGCTGCGACGATGAACCTGCTCGGGCATACGATGCCAGTGCCTCGGCATAGAGTCCAAGACGATGCTGAGCAACGCCGAGTGCATGC
CACGCTCGACCGTTGAAAGGATCCCGTTCCAGGTACTTTTTGAGATAGAACATCGCTTGCTCATTGCCGTGCTCTGGAGAGTTAATGATCGATTCTCCGA
CGCTCCCACCAAAATCAAGTAATGCCATGCTCAAACCCAGCAAAGCATCCAGATCCAACCCTGTTTGTAAAGCGCAGTCGAACGCTTCAATCGCTTTTCT
TTGCTGAACTGTCGAGTTTGCTTGGCGACGAGCCAGCATTCCATAGCCATTCCACATGCTCGGGTTGCTTGGATTCATGCTTTGCAGCTGTAGAAACGAC
TTCTGTGCCAAAGAGGCCGTCGTTGGTACGGTATCAGCCTGCGTCAGATAGAACATGCCCAGATTGGCCCACGTAGCGTCGCTGCTCGTGCCAGTTTGAA
CTGCTCGTGCCCAGGCAAATTGCTTTACCAGCAAATTGGCAGACACCAGTGCCAAGCCATTCCAAGCCATCGAACACGACGGATCCTTTTGAAGGGCCAA
CTTGAAATTTGTCGAAGCGTTCGCCTTCAGTGTCGAGACAGAAGCGTCTGCATCAGA