Description :
From Genome Similarity Track
Location :
contig_47:320660- 323407
Transcript NameFunction/comments
g7885.t1succinate semialdehyde dehydrogenase, mitochondrial precursor

Sequence
2747 bases(100 bases per row)
CCCCAAAGCGTGCATAAACCGCTGGGTGACTCTACTGATACCATGAATTCGCGTCGTTCCACCGGCAGTATTGGGACTACTCGATCACTCCAGTGGCAGT
ATCGATATGGTTACGAATACGACGCTGACGGTAAGCTTGTCAAGAGCTCCAGGTCACAACCGCGGCCTATATGGACCGAACACACTGACCCTGACTGCGG
CATGGCCTATTACTACAACGTGCTCACCAATGAGTATCGATGGGAGAAACCTGCAGACTTCGACATCAACTATGAAGCTTTTGCTAGCGGACGTAGTGCA
AGCAGCTCCGCTCGTAAGTGGTTCGAGATGGCCCATCAAAAGCAAAATGCCGACGGCAGCAGCTCTCTCAGTTCTCGATCGTCGAAGACGCGCGCTTTCG
GAAAGAAGTGGGTGGAGCTGGTCGATCCAGAGACGCAAAACACGTACTACTACAACGAGGTGACAGGAGAGACGCGGTGGTCCCTCTCCTCGCAGTGCAT
TGGACACTTCAGATACGGAAGATCAGATCTCCTTGGCCCTGCTCGCGCAGGTGAAGCAACTTCGCGAGACGCCAGTGCCGTATTCATCTCGGGACCAGCA
TATGAGCTGGCTGGAAGCAGCTATCGCCGAGAAGGGCTGGAAAAAAGCAGACGCGATCGTCCAGCAAATCTTCATTCGTGAACAGAGCCAAGCTGTAACT
GACCGTCGAGCTAGAATCGCAGCCGAGGAAGCGGCGAGAGCACCTGTCACCTCAGATACAGCGAGCAATTTCTTGACAAGCAGCAATGTTTCCTCTGTTT
CGACTCCGAGCGCTTGGATCGAATGCACTGACGAAAGCAGTGGCGCTACGTACTTTTACAACCAGGTGACCGGAGAGACAACGTGGACCAAACCATCAAC
AGCACCTGCAGGTCAGTGGGAAGTGGTGCAGGATAACGATGACAAGGCGTATTACTACAACCCTGTCACAGGCGAGACGGTATGGTCAGAGCCCACCCGG
TGAGTTCGAAGGAACATATAACTTTATTCCACAGTACACGTCTGGGTCAAAACAATCTGGCAATGGAAACTTATGCCTCCAGGCCGCCCATGCAGACCAT
CTTCGTCTCCTGATACTCGTCCAAGCCCATGAACGAACCTTCACGACCGAGGCCAGACTGCTTCACGCCGCCAAACGGAGCCTGCACGTTCGAAATCACG
CCCGTGTTCACACCGATCATACCGCAGTCTAGCGCAGCAGCAACGCGCCAAGTGCGAGACAGGTCCTGCGAGAAGAAGTACCCGGCCAAGCCGGCCTCCG
TGCCGTTGGCCATCTCGATCACGTCCTCTTCAGTAGAAAACTTGAACAGCGGTACAACGGGTCCGAAGATCTCCTCGCTCCAGACGCGCATGGTGTCGTC
AACGTGGGCGAGCACCGTAGCCTCGTAGAAGTTGCGGCCGATGTCACTGCGCTTGCCGCCAACGAGAGCCGTCGCGCCGTTCGTGACAGCATCCTCCACG
AGCTCCGAGGTCTTGAGGAAGGCGTTGGGGCCAATCAGCGGGCCGAGGTTCACGCCTTCTTCGCGCGGCGGGCCCATTTTGAGCTTCTTGACGCGCTCCA
CCAGCTTGGCCGCGAACTCGTCGTAGATGCTCGCATGGATGAAGATGCGGTTGCTGCACACGCACGTCTGGCCGGTGTTGCGGAACTTGGAGGCCATAAG
GCCGTCCAGGGCCTTGTCAACGTCGGCATCTTCGAACACAATGAACGGCGCGTTGCCGCCGAGCTCCAGCGACACGCGTTTTACCGTCTCGGCAGATTGC
TCCATCAGCAGCTTGCCGACGCGAGTAGAGCCGGTAAACGAGATCTTGCGGACGTCGTGGCTGCTGGTGAGCGCTCCACCGACCTCGGCCGCCTTGTCAT
TGGGCGACGGCACCACGTTGATGACTCCGGCGGGAATGCCGACGTCCTCCGCCAGCTTGGCCAGCGCCAGCGCCGACAGTGGCGTCTCCGCAGCAGGCTT
GACCACTGCCGTGCACCCTGCAGCCAAACAGGGCCCCAGCTTGCGGGTGATCATGGCCAGCGGGAAGTTCCAGGGCGTGACGATCCCACAGACACCCACG
GGCTCCTTGATAGCCAGGATCTTGTGGTCGGGCGCCGATGTGGACGGCAGGAAGCCGCCCGAGTGCATGATCTCATGCGCGTAGAAGTCAATGAAGCCAG
CAGCGTAGGCCACCTCGCCCTTGGCCTCGGGCAGTGGCTTGCCGCTTTCCACGGAGGCGATGACGGCCAGGTCCTCCGTGTTGGCCACGATGGCGGCGTG
CCACTTTTTGAGCAGCACGGAGCGCGCGGCGGGCGTGGTCTTGCGCCACTTTTTCTGGGCCGCCAGCGCCGCCGCGATGGCCTCATGGGTCTCGACGCGA
CCCATGTTGGCCACGCGCGCGATCTCCTTATCGGTGGATGGGTCCATCACGGCGAAGTGCTTGTTGGAGTGCGCCTCGACCCACTTGCCGTTGATGAAGC
CCGCCGACTGGATCAGCTCCTTGTTGTGCACCTCGGCGTGGAAGAAGCGGCGCGTGGCCAACGAAGCCGATGGCAGCACGGAGCGGTGGATCTTGGACGA
CAGCATGGCGGAATGAAGGGCGAGCGGGCGCGGTTTGGGCTCGACGGTGCAAGTTCGGAAGTGAGCCGTTGCGGAAGCAGTGCTTCGACCGCCAGGACCA
CTACTTGGCGTTTGTATGGGGTACGTCAGCAACGCGTACGCTCCCAA