Description :
From Genome Similarity Track
Location :
contig_15:32048- 33879
Transcript NameFunction/comments
g3343.t1polx_tobac ame: full=retrovirus-related pol polyprotein from transposon tnt 1-94 includes: ame: full=protease includes: ame: full=reverse transcriptase includes: ame: full=endonuclease

Sequence
1831 bases(100 bases per row)
GTAGCGTAAATAGCGCCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCG
GTATCCTACCGGTATACGACAGCTGCCCGAGGCGCCTTCTTGACAATATGTACCCATGTCTATTGAGGGTATGGAGGGTATGGAGGGTTACCGGTTTGGT
ATCGGTTGTTTACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGATTACGCCACCGACGATTACGCCACTGTCGATTACGCCACCTG
TGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCA
GTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCTTCGTTCTACCCTCAAGTGGTTTCCAGTCTCCGCTCCGG
TCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCCAAGATCCATACCTTCCATCAGGTTATGAGCCCAAGCACCATGTCCTCTG
CCCACGACGCCTCCACCAAGGTCTCCATCGACAAGTTCAACGGAGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGTTCCTGACCAAGTCGGT
GTGGCATGTCGTGAACCGAGAGACGACGCCGAGCTTCACGGACTCGCGGCCCAAGGACGAGTACGTCAAGTCGAGCAACATCGCGTTCGGACTGATGTTG
CTCCACATGGACGCGGACTACCACCATGTGGTCGACGACTGCGAGGAAGCGTGGGTTGCGTGGACGCGCCTGAAGACGCTGTACGGTGGTTCGCAGAAGG
CTGGTCGCATCTACCTGAAGCGCCAACTCTTCAGCATGGAGATGTCGGAAGGCGGGAATGTGACGAAGTCGATGAAACTTTCTCGCCCAAGTGTATAGCG
GTAGCCTAGACTTAGTCCTGAAACTTAAGCCTGGGGGGTGTAAACCCTGAACGCGGTTCCTTGAAACCGTGATTCAGAGTGGCATGGCACCTTGTGTAAT
CCCTATCGGCGTCGATTGCTTCGGGGGAAGCCCGGATATATCACTACAATGAGTTGTCAAATACAAATAGGCCTTGAAATGCTGAGCGTAACGTCCACTT
CCTGAACGCACTTCTCCAATGTCTGGAACCGGTATCGAGAACTCGGAACAAACACCACTTTCAGATACCCAATACAAATACAGAGTTATATACAACACGC
AGCCGTTACTTATTCTTATAGACCCTTGAACGGTGGGTCTGAACACCAGTCAACTAAGGCTGAATCCAGGATACTGGTCAATCCTGAAGCCTTTTCTTCA
CACGCGCACCACCCTCAGATGAGGGAAATAATACACACCAATACAATCCTATCTCAAACGCAGTCTATCAAATATTCCTGGGGATGACTGCTACTATCAC
CCAAGAAGGCCTTGTTAATATGAAATGAAAACCCCGCCCTTACCGTACGCGCAGCGGGTCCAACTAATATAGGGAATGCAAGGATCACGTCAAATACTTA
CGTGAATGATCCCCTCGCAACTGGGCTTGAATCTTGTAGAGAGCCCCGCACCGAACTGCCCTTAACTGAACGGCGGACCCGTGTCCTGCTTGTCAGAAGC
TCACTTACTTTGAGCGACTTGCGTAGTAGGGGGTTAAACGAACTCTGATTGTTATCTTTGCTAGCCATCGCTAGCTTCTTCGTAAAGGGTATCTGTCTGT
CTTCGTTCTTCTGTTTCTTCTGTGTTCTTCC