Description :
From Genome Similarity Track
Location :
Scaffold_70:320470- 323128
Transcript NameFunction/comments
Physo_139141hypothetical protein
Physo_139142hypothetical protein

Sequence
2658 bases(100 bases per row)
AGTTGCATTCCTGTCGGTGTGCGAGGCTCTTTTCAGCAGTCACGCGGTCCATTCTTGCCAGCGTTTCCTGGCAGATCTCTCGAATGCACACGAGCTCGTC
CTCATCGCCCGCAGTCTCGTCCAGAATGGTGTTGATCCCGCTTCGAAGTGCCGCCTCGTGCAGCATTTCCGCCGGCGGGATTATAGCCGGCACGGGAGCT
TCGTGGGCAGCTAGCGCCCTGACGTCTGGAGACCCGAAGGCGTCAGTAGCCACGTCCATCTCCAAGTCCAACCCCGGTGGCTGGCTGCCGCTCAACACGT
CCGCCATTCTGTCTCTCTGCGCCTTCGTCGCCTTCGACGTCGCTCAAAACTCAGGCAACCAACCCCCACAGCTGCCCCCAACCGCTATATATACCGGTGC
TCGCCACCGTCTCGTGGCGCCATCACGTTCCGTTTCACACACCTCAGGAACTATGAAAACTGCACACGTACTCAGGGTTGGCAGCTTTCCTAGCTTACTC
GAACGTATAGCCCATGGTCCTTGAGATGTGTGGCCTTCGTCACAGTGGCGTCGGGATATCCTGCCAAGAGATATCTTACGCTGAAGACACCGCATACCAC
ATGCAGCAGCTTGCTATCAAAATGTCCCTAACGTTGGCTCGGTCGTCTTAAGCCTTTTTAGTCACACACGACTCACCTTGACGCTTGTCCTAAGCCTGAG
CACCTGCAACTTCAACTTGGTGAGAGTGATGGTTGGGAAGTTGAAGTTGTGTTGCACGAAGGTCGCAGCAGTTGCAGTCGGCGACCTTCCCTCAATGAAG
AAAGACGGCTCATCCGTGGCTGAAGGCGATGCTGATAGCCGCGCGAGGGAGCTGCGGCGCCGTGTGGCCAACCGCCGCCACACTGGCGCCGCCATCTTGG
GCTCACTGCCTCCCGTGCAATCGCTCAGTCTCCCGCAACTCTTCTACGCGAAGCAAGAGGCGCACGAGATCCGAATGCAGCTGATCGACATGCAGTCGCA
GCATAACGCAGCTCTCACCTACTGCGACCAGCAGTTCGTCGTGGAGAAAAATGTCCGGTAAGGAAAAAATATTTTTTGACAGTCATATTTTTTCTTACAA
TTTGTTTTTTATTTGATGACAGAAAATTACGTAAAGGAATCGGAGTGACTCAATCGCAGCTCAGGGAGAAGACGGAGGAACTGGATGAACTTCAGCGACG
AGTACTACGAATGACCAAGACGCTGCACGATTCATCAGACGAAAAAACTTTTGCCAAGACAAAATTGGTGAACCGAGAAGAGATCAGACAGCAGCAACTA
CATGCTACATCCTGTGAACGTTGCGGACGCCAATACCTCCCTCGAATGTTACGGATCCACCAGGATAACTGCATGGGTTCTTCGCTTCCGACGTTACAAC
CAATTGTAGGAACAAACCAAGTTGCAGATAGTTTGGAAGTTCCGAGAGGAAATTCGAGTTCCCTCCCGGCGATTGAGGAATCACTTGGTACGCGGGTAGC
TACGAAGTTTGTATCCCAGCCACCTCGGAATCTTCGGGTGGAAACGAAAGATATTTCGCACAATGCGGTGACGATTGCGTGGGACCCGCCGATTTTTACC
GGGTCGAACGCCATTTTTGACTACGAGTTGACGTACTCAATCTGTCACACGAAGATAAAATATGATGAGGTACAGCGGCAGTTTGAACCTCGGCCAACGC
TGTTGTTATCGCGCTGGTGTGTACAGAAACCTGTCCCTGGTAATAAGTTTTGCCTGACTAACCTGTGCGCAGACCAGGAATACGGCGATTTTTCCATCCG
TGCGATTACCGTTGCAGGAAAAAGTGAACCAAGTAACAAAGTGGATATCGTCCGGACAGGGCCCGCTGCGCCTCCAACTATCCCGTTGTTCCTGTGCGTT
GGAGTGGTTACAGCGACGAGCATCACACTTACGTGGATGGAGCCACTGGACGACGGTGGAAAGCCGATTCAAGACTATGAGTTGAATTTTTCGGAGGCTG
TGATTAAGTTAGATAATGCTGATGATCGGGGTAAAGCATGGCTTGACGTCTCGGAGATCGAGTACAAGCCTCGTCGAATAAGGACAAATTCTACTGGGAC
TTCACTAACAATTACCAATTTATTGAGTGGTGTCGAGCATCTGAACTTTCAACTTCGTGCTGTGAATGGTGATGGAATTCCTAGCGAATACTGCGACGTA
ATCAAGTCAATTTTCACCATAGGTAGGTAAATCTGTGTTTGTGTTGATACGATCACGTTCTAAACTGTTGTCTTGGATTGATTGCACAGCACCGGGAAAT
GAGCATAAGCTTCTTGACGAGTTGCAGGCTGCTGTGAACTCGCGCTCGCGTACGGTGGACTCCCAGTTTTTAAGTGGTTTCATGCAACGATATGAGAGGC
ATCACTACATCGAGCAAGTATCGCGCTTCATTCTTTCGATGCACCCAGAGCTACAAGCAAAGGTAGATGCCATCGTAAGCCGAGGTTCGGGTATGAATGA
AGACGAAGGGAGCGATAATGAAGAAGATCAACCTCAATCCATCCAGCAAGCCAGTGGCCGGAAGAAATATGACGATCTCACGGACGAAGAGAAAGTGGCA
GAGCGTCGGCGTCAATTTCATTTTCGTATTGCTGAGATTCGGAACGATCTCAAGAAGG