Description :
From Genome Similarity Track
Location :
Scaffold_40:320463- 333224
Transcript NameFunction/comments
Phyca_LT1534551085PREDICTED: hornerin-like isoform X1
Phyca_LT15349658Hypothetical protein
Phyca_LT1534120129inositol polyphosphate multikinase, putative
Phyca_LT1534120033Hypothetical protein
Phyca_LT15349660Hypothetical protein

Sequence
12761 bases(100 bases per row)
ctggtggtgacggatgacggtgtctggactaaaaattagtgccaacacaaatgttattatgtcggactaaaatctcgaacaaaatccgtcaaatgaccat
gcccaaagtgtgtacggagcctggctgtactcgcctagtgcgctctcgaggccgatgcaaagctcacggcgggggccgtcgatgctctgtggaaggctgc
gaccgcggcagtcagacccaggggctctgtatccgccatggtgggggacaccgttgcactagtcctggatgtactaagtcgtcacagtcgaacggactct
gtaaagcccacggtggtggtgctcgctgccaatacccagactgcacgaagagcagccaaggcggcggttattgtcgtgcccatggaggtgggcaacactg
taaagaagaaggatgcatgaaaggagcgcaacgcggaggtttatgtgcgagacacggcggcacgaggttctgtcagcaccccggctgttccaagaacgac
cgaggtggggggctgtgtgctaagcatggaggaaaagttcgctgtactaatggaggctgcaagaagctggcaaggatggttggtcagtgttgggagcact
gggctgcaactaagggcgaactacctgacgatcaagtggcggcatcgactacagaagaggcgcaacttgagatcaagagttgtggatcacagggtggcgc
tgctggttctgttggtcccgctgttgttggcttatcaaaggaaaacgtatctcggcagcatgtaggagaagagagttcaaatggagtgcagacagctttt
gcaagggcatcaacaattgctgcctaggaatgtacgttggtttaaaaccatttctaacgttagattacagtttctaactgtactgtatttttctttgatg
ttgaaggatacatgtttaaaacgagacgtcctcacttttaataccgattgcaaatgacggaggaagttctcgccgacgacctcttcttctgcacgcaagc
agcatccgtcgtcaaagtggctgtgactgacgacccgagcaaaattacggagatccaacacattgcggacgccgtttgtggggcgatgccgagcgacgat
caggtgagttgagttacagtagtcaagttgttcttgagccttgctgatacttgctctgtagtgtcactcattcatgaagcgtttcgatgctgttgttaaa
tctatccggaaaagcggggagccgaaatctatttgcaataacctgaagaagtacccggcggacaccaaccttcccaagccagagcttacagaacccgata
tgatcgcattttatagcagaagcaatgatggcagctcgcctgcctactgcagtggcattgtcactgttctcaagcacgcgctagctcagaaaccggaacg
cgttaaggagatgcgtgaagctgcaggtcttgtgtgtgggaaacttcctgctgaggatacggtatggcgaaggtggtttattactttcagtgatgaaaga
ctgacgtgcatttgctgatgtattagtgccacgacgatctcaaattgtatgatgaagcagtggccaaccttcaatctgggaaatatcctcaggaagtttg
ccaagcactgaaagtatcaccaaaatcgaaaactctgtaggtattatagcttaccatggcgaacaacccttacgatggctcttgtgaattgattatagaa
cttcagcaccgtaaagtggacctgaagttttacaaaccgttagactgtcgagagctaaaggtgcaagcatctcgatgagctcgatggagcagtaatgaca
actcggcgagttctcttcacaagcgaccacgtggtcccacgtttggaaacccttggtcggaactgcataccgaaacacagtgattcttcagccatgacta
acaaagcttggacaggtcttgaactcacgcagcactgctgcggcagcagttcaaatatattgagcatcgaccttgcgacgcacgttgcgcggcacgaagc
tgctcacgccaggatagcaggaagcgctttgatcctccgtcctctacttctccgtgagaagttctcacgagaagctcttgattctcgtcccaattggaac
ttccaacagtccctgtctacagttctgcatcagaatctgttgccctgccgggccggaacttctggtagtgcgaaaagatcttttgatcaataacttcaag
ttgcacaagcttgtcttgtccccgtcaactagggcttaacttaatgaggctttttaggctgatgttgctgtgttacatgcccctccacgctgtcgtcgcc
tgtgcggcgagtactgaaatgaagtcatgctccccctcactgtgaggctcacacacgtagcgcgcataaggcgggccgaggtcttcttcgggttctcatg
tgtgcgaccatccaaatggtcttccggcagaaaagggcaaaggccttttgtatcatcactccaaagtttggggtctaaacgcatacgcacggcagcgtgg
cgggcgagcttgcggtgagctctagaacaagagcgcggccacggagatggaggacaacgtatttaattgagtggcaccgcgcggcgacgcagacctcaag
caaggagctccggcagccgagatgctggcatcgacatgagtgcacaaagcgggcgccgccgctacagtacggctcggtccgccccgccggtgctttctgc
acgccaaagcccttctcttgcattgcggagctcgtcaccaagatctcggggcgataacggaaggccgccaagcagcaaaaagtcacatgtccggaatgac
accgacaattgtccccgccttcttgcaattgtactccatgtattattttctatcttcttcgcgcatgcaggtcggggccggcatgtacggactagcggat
cccgagctcaatcctacgagttggcgccgtcgccgccgcgctccacccacctcaggctcagcgtcgtcgacagcattcggagctgacgaaatcgggcgtg
ctttgcaatcgtcctggaaaccagttgcctttggtagcgccaggcgctctgcgatacgcgaagagccaggcctcgccaatcacctcatctcgcctagatc
aagtgacctgtagctgctgtttgccacgtgcagttgttgccaccgttacttcaaaagcgccggggccccgcccaccaagcgttgatgaccccgatgagct
gcgatgcaatgtctgcgaagctcacggtcaccaggcggcgctggaaccaacgctagtgtcccgctgcagtcaaaatgcttgctgcctcgaactaatgaaa
tgtagccacgtccgtgcacggtgttaatctcggcgccgcggtttcgtagcggcatcggcgacgaccgccgtggctcttccctctatgtcgggcgtgccct
tgcaattctgaagtgtaaggcaaggcctccgccacgcgcgaccggccttgtgtttgaaatgcgcaccaaaagcggccatgccgctggacgaaaggagaga
ccggccactggcccagtattgtcgaattgacgcgaccgttatgggtctttgcggcgaaaagggccacgcagtcactaagatccgtagaggtcattttgtt
cacagcaaagcgagcacgtttagaagctctgcagaggaccagcatgctgcagtgcaaccacggcgagttgctgctgccaaaagcggttgaaagagggcaa
ggcacatcgtgcaggagctcgctgctgttctcgcggcattcacatcgccgttgatgaaatcatacagtttgacttgcattttggcgaccagtatgcgcat
gcctatgacacgccgttaaatcgttttgaattccgccaattacagcgcgatcagctccatttgaatcgcgcgcgaaacgcggcgattggttcatcttgcg
ctctgcgttctctcttgtcatgcatcacgcgtcagaaaacgtccggaatgggacacgcgaagggatctggaccggctttgagcgaaaggggttgtacctt
tgcgaccgcgtcgtaagccgtgattagatggccaaattcgttggagcaatggtttcttgctggacaacaagcaagtttagcaaaactatcttcgtcgcta
cgagcatcgagttattttgcttgccaaaaagtgtcaaccgccgtatcagtttgacacacttttctcaagagaacagccacaacgctgcgattcaaaaaat
gactcgcagctgcacccctaccctccgcggctgccccttctttcccgtctgtgcatagccagatctcgaggggggcgagctcggagtgagtggtcgtcct
gcgcttaccattgtgtttcctaccaggccgttggtactcgcttcgtcttcgctctcgtggtgcccgtctccgaggccccaagtattttttctgccggata
ggggcagctagttttatggcctccacacccgcgtcctcggcgtcccagtccacatccaccagcagtgccatgcagccacaagatcccagcgccgcactcg
acgcctcggcctctcaggccttcaattacgacgcagcctcctaccagcagtacgcgcaggagcgagcgctacacgaccaggccgtgcacaactccatggc
ggctgtcagtggctcagctggggcttctaagtcagttaccagcgcagctccatcgcagactaaggactccactgctacacgcccgaaggtggaggttccg
tctgctagtacgtcccccacaagcgtcaccaaggtcgaggcttccggttctaccgctgcggctaagactgcatctgctgccacgcctgttcgcaatgaat
cgctcaagtctaaccgtctctgcacgatgcctggctgcaccaaacgcgtgcgttctaagggtctgtgcaaggctcacgggggtggccgtcgctgcatggt
cgacggctgcgagcgcagcagtcagggccaaggcttgtgcatccgtcacggcggtggcaagcgttgcacgcagccaggatgcaccaaggcgtcccagtcc
aacggtctctgcaaggcccacggcggtggccttcgttgccagagccctggctgcaccaagagtagccaaggtggcggcttctgccgtgcccatggtggag
gtcagcgatgtgagaaggaaggatgcaacaagggagctcagcgtggcggcttctgtgccggacacggtggaagccgtttctgccagcatccggactgcac
caagaatgaccgtggcggcggtttctgcgccgaacacggcggtggcaagcgctgtgaccaccctggatgcaacaagcctgcacgtaagaaaggaaaatgc
tcctaccacgccaatgctgccaagggcaaactccccaaggaccagctcgctacggccggagtggctgcctctttgccgcagcacatgatggatatgcgac
agattactacgccgacatttgcgatgggtgtgaaggatttgcgtgacccgcaccttgccggccaggttgatgcacagcgcgcggcgtacgtgcagcagcg
tgtggagatggatatgcgttacaaggcctacgaagctcctggcaatcccggacagtatctgcagattcacgcggatcagcgatcgtatgagccgattagt
ttgcaggctggtgctgccgctcgctaccacatgcctgatggaagcgcacttcctcctgtgtctggaagcatgtacaaaccacccgccaccatggatcgtc
aggcgtacgctgcacgtgcagcttcggagcagatgaagaacccgtacacgcagcactgggcggcgaagccggagatgccgcagcaccacccggacggaag
ggttgactatttcgatgtgaacaaggagcagcaacagcagcaacagcctggccaccacctgccataccccactcagtcgtcccagtaccaccaccatctc
aatgcagcagactcggctgccgctgctgcagcttacggccagcagcaagctccacgtgggtattacagccagcagccccagcaaccccccgcttccggtg
atcagtcggccgctcagcagcagcaacaacagcagcaacagccgaacatgatgtattactcgagtaacgggtaccctcagcaccagatgcacaacttgca
acagcagcagcagcagatgcaaatgttataagccagcaataccaagtgcagtcgccgaacgagtctgcttacttgcacgtcgtgctatttgagacgatga
cgaaccgagtgcaagagcgtgggacgaagtgaaccgacagcgctgctgtaatagagatagaaacaacccccacaatggatcggagctcctcgagtgcgag
gcagcggcagactagtgttaaattccgtcggcttgggaacgtaaccctcccagccagttttgatcgagcaaaaggaaggattgagcaaaatcattttccc
tatgtccatcttttgtcttcgtgctttccttttggtccatgcacagcggcaccaccaacatcttggtgtcttgtgcgcacagaagtctgcaaccagcatc
acctcgcccttctcttgcttgtacaagctcagtcgctttcggtgcggggccaagtgcctcgacggggcaatgcaatgcagcgtcaaaggccgcagccacc
tggttcaaaggctcaacatgttacagttcatcaaagtccagactacactgctctaataacggttaaatcctacgagctgttccgactcaactctgtcggc
gtggatgctcgtcgactcagcaaagcggcctcgtcctcatcttcaaagctgctcaaagcaccagtttcatgctgtagtcgggctgtgaaactggtggctc
gccgacgaggtgcaacggccgcggggcgtcttctactgggactgtcggcggctgtagggccgcgcacatcttcaagctttgcattacgagccgcacctgc
ccgtttcgactgcagcttggcctgcagataggtaccgatggcggacgttggtatatgcagcggaccgggggatgatacgcgcggagagccgatatcctgg
ttctcgtccagggccacgcggaagctgcctttgcctgcgtaatattgacgatagcattcgaccagctcgtgctccaagcccgcgtacgtctccaacagct
gcgcggctgaggcctcgtttccaggctcgtagacatgcagcagacgctcgagttccgctcggtagtcgtcggtatgtcgctggttgttgtctgccctggg
gctaccttggatcgaggtctgcggacgcattaggcggttggtatctcggaagaagcggaaatgagctcctcgctgcacaattctatattatatgtttttt
gaaacggcttttttccattctttggcttcaactagaccatgagttcataaatgttttagagtttttggacaggagttttcggtggtgcttgctggtaaaa
ctgccggaagacatggaagatcccagcagccttttttctaggactcataacctgctggtttgttgtcttgaacaacgattttcactcggcctgaacttca
gttaggagagtctggaagcactggatcaaagtggcaattccagtccgtagtccttcgtcacgtctgggagaaatgcatggcgttgcgtgggcgaagtcga
tgaggcggatgtcggctgcaaaggcctctgccacgccattgtcgtctttggccgagtcgttgccgtcatataaaaacaggaaggagctggcgataaactc
cgtcccttgttggtcatcgaaccacgccttcaactgatccagacgctgcaaaaactagattcaaaaagaagagcgttagaatggttaacttaccgagcaa
aacacttgaaataaaaccaaccgcttccaacaacttgatggttttggtcgtgccttccggtgggaaatacttgcggaaggccggggcgagctcattttca
gatacaatcccacgcccaaagtgcttgtcgaactcgacgtattcctttttcttcgaatcgaacactttaatgccttgaatacgaaatcccaccgtctcct
gtaaggggaacttggacttttcgtacgcgatcttctctggtgtcgcgtcttcctcataggacttggtgcccattttcacgtccataatgcacggccattg
tcttccccatgttaagtcctccagcattaaatactctgcattcagcgaaagatacgtaagttttggaactcaaaagctccattgtctcaatttgatccac
acgtacttccagccttcagtccgtccgattctctgccttcttccacctctactgtgccgtaatagcctggtagaaacttcctcagttccacaaactcggg
cgaatctttctctgacacaaaaacgcgattgtagaaatctgcttctcgctggccacgctgtttgctctgaaaaggctttaagatgcgtccattgtgagac
tttaggcctgccaaacgcagcgaaagatacgtattagataggcaatgtagactttctattgcattcgtcagtactcgtggcgtggccgcccacttggtgt
gccatctccgtgaagccctccattatttattttctgttacgataaaaaaatcaaaaatgaactataataactgattatagtccattttgtgacgactcag
attgcaagtgaaaggtatggcacgtgtgctagtgcttgggggtacaagctacgtggggcagttcgtgctacagcgtctgcggcaggacgaaacgcttcaa
gtaaccaatggaaatacattaaaagaaattgacgcggtggcgtgcacgatgcgcagtgagccatttgctctccctgaaggtttttcctcgcagtcctcag
taaagtcgaaacgagatgtgcgcgtgtattggcaagtggatttattatctctggaagctctagaggagtgtattaaggatttccacccgacggtgatctt
caattgcacgggtacgttatgatggggcatttattacaaaccatatactcaaatcggcctttgtgatatgtgtagcgatttcgtcgcctgcggcgtgtca
aaaagacccggagaaggcacgtggcattaatgaggtaacgcgtgaaagaaggagttgaaacaatgtttttggcactcatgttcatgtttttattcggtag
cctgaaggtttggtgagatttttggagaagttaccgtggcgaattagtttcgtgcacttctcgacggacttcgtttatgagggaacacagtcttgtggca
aaagttatgatgaagatgatgctgtgttgtctccagacttgtcagtgtatggagctgggaaattacgttttgataaattcctgcaaaaacgcaacagcca
agcatcttcgttgcaaatgctgatcctccgaattgccaacgtgattggtccgacagctcctatctttccagacagcagtgccccgaagtttatgcagtgg
ctgcatcgtcaattattccagtccgaaattgctcatgcaccgttgaagttgtggagcgatgagttccgctcgtacctgtacatctccgacttaatcgaga
tcatgttccagttactagctgtgaacgccaaggagcaaaccactcttgtcaacgtcggtacgtcagtaaaacatacgtaaggttgataagctttgtacgc
tctaacaatgtttcgtgtaggaggggccgaggcactctcacgcgttgagattgcacacaaatatcttgctgccagtgcgatgcacaaccccgaagctgtt
gctgaagtaacgagggaaattgtgcctacgtcacgatctcaaattgatttggggtatccttcacccctcaacacgaagctaaacactacacgcctcgctc
atttgctgcctagcttcgcgtggacacctacagatacgattgtggacgagatcagtcgtagttttatggcttgaaaatgctatttcattcaggcattatt
tttttgcattcattagtggggggggggggggggggggtatggcagaacacagtcaccaagtagtcgaaactacacaagagaacgcgccccactcgcgatg
ataaacaagagctctccagttgcaattactggatctccatcaagttgcccatgctctgccgtccgttctcgaaagcttgcacgataggatcatctgctcg
gctcccggagaagacgaagtctgcgtcgcacagagcgatggcgtgacaggcttcgctgggactctttccctgacgcatgagcgccactagctcatcaaac
ttggaggaaagcacatcacaacgcgcacgcggaggcaacaccgagcacattgtctccagggtcatcttggcctcgcgtaaaaccttctcatcatccttgg
cgtgctccaagagatcggccgtgtactcacagaacaagcagcccacagacatcgatttttcctccaccttctcctccacgaccgtagttccacactccgc
aatacgattacagatagtatccacgtcttcgttcttcttcagtgagtcaatgattacgtcttgatgcttcaagagtagctcacactatttcattcaacaa
catatcgagttaggcacctgatcaattcaaaagcagaatgtgggcagcacacttacctcactggactccgggatcaatcggcagattgagttgatctcgc
gctcaaacgtgactaagctgtccgggcgcgaaatcaacgaagcgagcagcagagtattctgctggcaagttgcgcatctcgaaggcaggaagtccttgcc
cgtgaagtcaagcaaacccgttaccagtccgctgggattttccatggcagtgcagaacttcagtgtttggcaaatttcttgaggctcctttccagcttgt
aggtcggtcactgcttcgtcaaacatcttcaagtcgtcgtggcactggtcaaaacggacaaacagtacgcacatcagttcctactgcagcaaagagcgca
taattaacaaagggcacgtaccgtatcgtcagcaggaagcaattgacacacgatccctgccgcttcacgcatctccttaacttgttccggcttttgggca
agcgcatacttaagaacagtgacaacgccactgcagtaggcgcacgagttgcttcccttgtcactgttctgaacagagattatttcgggcaccgcaagct
tcgccatggcagggttggtgtccaccgaacagtacttcaggtcatggcagatagccttcggctgttcacccttctggagagaatcaagaacagcgtcaaa
ctgcttgacaaacgcgtgacactatagcattccacagagcaattatcagcacgatttcaaatgcaatacggagtaggcaacgtacctggttgtcgctcgg
catcattccacaaacaacgttggcaatctgtcgaatctgcgtaatcttgctcggatcttcagccacagccacttggatgatggatgccacttgagtgcag
aaaaagcatccgtccacagatacttccatcgaatctttcaccatttgcaccaaaaccggatcataatcagacaaatcactgtccccatttgcttctctat
cagcgatggcaaggtgctcctccgttgttgtacagaactgaagttctgtgcaaatagccttggcactcatacccttggtgatagaatcaatcacgaagtc
aaagtccttcacgtaaatgtggcacgggttgtccgaacccaacatatcacaaatcatgtctgcgtacgcgcgaatttgacgaatatcggtgccatattgc
tggagcgcaatcttcgccacagtggttgcaaattggcaatacgtgcactgagtcgcgtttccaggaggccattgagaagccacgaccacacccttcattt
catcggcaatggaaggcttatcttcctcccagtcttgcgtcttgttacaaaccccaagagacttgcagatttcgtgggggtgcttgccttccttctccat
ttcaacgattttgtcgaagtttttgtctactacatcgcacttgcacttcgacggcaccagttggcatacgtttgtcaaaatggttttcacaaccggcaac
ttttctggcgacgtgtgattaacgtggtggataaccattgcaacacgcgagcagaaaaagcaactaccgtggggatgcgggcgtgggtggggagggtggg
gtgggtgttcatcatcttccaagttaccacgcgggctaagatcgtgacgtccatggcggcctccgggacccaccatactcacacggtgatgcatgccacg
aggaccatttctcatcataccgacacgaaggttctcctccaactcaagagatttgtccatttgttctgccaagcagtatttcagagtcttgcaaatgtca
cgagggtgtactcccttctttaaggagtcaaccacgatatccaactggttcacatactcgtggcacgggctgtcatcccccagcataccgcaaatcatgt
cagcgtagtcacgaatttgatcaatctgctcaggggcttcttgtagaatgacctccacgacagtagtggccgcgtcgcagtacacacacgtcttgtcgcc
gcggatcgaatgcgagggtgtcatgctacgtgtgggtttcgcagggcagaaatcagcactagcacaaacctcacgtgggtgctgaccttgctgcactaac
tctacaatacggtcaaagttggcctccacttcttgacacttggattccggcgaagccatctcgcacaccgttcccaataccgacttcagcatcggaagct
gttcggggaacaactcgttaacttggtaaacgacaccagctacatgactgcagaagaagca