Description :
From Genome Similarity Track
Location :
Scaffold_16:320418- 321602
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G006763Similar to ABCA2: ATP-binding cassette sub-family A member 2 (Homo sapiens)

Sequence
1184 bases(100 bases per row)
ACTTTGAGCCTGTGAGTGGCGAACTTCGCGAGCAAGAGCGAAACGGAGCTGTGCTTTCTGTCCAGAGTCTACGCAAGGTCTTTCCAGTACCTGGTGGCGA
AAAGATTGCGGTGCAGGGAATGAATTTGGTGATGTACAAGGATCAGATCACGTGTTTGCTTGGACACAATGGCGCGGGCAAGACGACGTTGATTTCGATG
CTGACGGGTATGACCGCGCCAAGTAGCGGAGATGCCACTTTCCGTGGCTTGTCGCTGAGCGGTGATATGGATGAGATTCGTGAATCGCTGGGTATCTGTT
TCCAGCACGATGTGCTTTTTGCCGACCTGACCGTTGAAGAACACTTGCTGCTTTTCGGCCAAATCAAGGGATACGTGGACGAAGAGTTAAAAGCAGTCGT
GGAGAACCAGATTCGTGAGGTCGGATTGACGGAGAAGCGCCATGTGAAGTCGACCGAACTGTCGGGAGGTATGAAGCGTAAGCTGTCTGTGGCGATTTCG
CTGCTCGGTGACAGCTCTCTGGTGTTCCTGGATGAGCCAACGTCTGGTATGGACCCGTACAGTCGTCGTAGTACGTGGGAGATCTTGCTGAACAACCGTA
ACGATCGCGTGATGGTGTTGACGACCCACTTTATGGATGAAGCTGACATTCTGGGCGACCGCATTGCTATTATGGCTGAGGGCGAGCTTCGATGCTGTGG
GTCGTCGTTGTTCTTGAAGAATCGATATGGTGCTGGGTACAACTTGACGCTGGTGAAGGATGAAACAGGCTGCAACGACAACAACTTGATCGCATTCATT
CAGTCGTACATTCCAAATGCGCAAGTGTTGAGCAACGTGGGCAGTGAGATTGCGTTCCAACTTCCGTTGGCGAGTTCATCTGGATTCGCAGCCATGTTTG
CTGAGATGGATAACCAGCTGTCGACATTGAGACTTTTGTCGTATGGCGTGTCGGTGACGACATTGGAAGAAGTGTTCATCAAGGTGGCTGAAGCGAACGA
TGAAGATCACCAGCACACTCTGGCAAAAGAAGGCCGAAGTGTGTCTCCTTCCGACACCCCTGTGAGCTCACCTACAAGTCGTTCCGAAATTGTTCAGGAC
AAGGGTCTTTTCATGGTGCATCTCAAAGCACTGATGCTCAAGCGCTTCCAGGTTGCAAAGCGAGACAAGAAGATGCTGGGCTAC