Description :
From Genome Similarity Track
Location :
Scaffold_4:320401- 325659
Sequence
5258 bases(100 bases per row)
CGCCGACTTTGCAGCCGACAAGAGCGACCGCAAGTCTGTGAGTGCGGCAATCATCCAAGTAAACGGAATGACTGTGTCATGGCAGTGCAAGAAGCAGAGC
TCCGTGGCACTACCGACGACCGAGGCGGAGTACGTCGCTGCGATAGTGGATGTTCAGGAGCTACTCGGGCTGAAGGAGCTACCGGGTGAGCTGGATATCG
CCACCAAGTTGCCTATGGCCATGCTGATGGACAACCAAGCGACTATCGTGCAAGTGCAGAGCGAAACAAGCTCGGCCAAGGCGAAGCACGTGGACGTCAA
GCTCAAGTTCATCCAAGACTGCGCCAAGAAGGGCGTCGTGGTGCCAGAATATGTGGCTAACGCAGAAATGCTTGCCGACCTGCTGACGAAGGCGCTACCG
GCGCCACGGGTGAAGGAGCTACGGGAGAAGATCGGACTCGTCGACATCGAGTGATTCAGGAACCCCGAGGCTCTGGGGAGGAGTGTTTTCCATTGATGTA
AGAGCCAGCCAACAGACAGGCGACACGGAAGCCAGACCCCCAAGGACCTTTACGCAAGTGTCGAGTCGACAATGTTGAAGGTACGACATTTTGACTTGGT
TTCACTATTGGGACCAATCAGATCGAGTGCAGGCGCGTGTCTTTTCAGGTTATTGTGTAGTGTGCATGTAGAATCCAGCTAAAAAACTTCTTTGTATATA
TTTCTTACTATCACTTCTACCTTCTGCCGAGCCAATGTAGAGCTCAATTCTGCGGATAGTGAGGAACACCCTAAAGTGGACCACAAAGCTGCTTATTCGA
GCAGATTTAGCGGGCGAAGTGAACAGGGGCTTAGAGCGATGCAGAGTAATGCAGAGAGGGCTGCGAGAAGAGCTAAGCATGAATGAAGGGTGCAATCACC
AAGTGACGTGCTGCACAATAGTGACTTTCCCACTTCGGGAACCGATATTTTATTCTTGGCTGAGGGTATTCCATGAGCAGGGATTACTACCGAAGGGTTC
ATCTGAAGTGTGTTTCATAGCAAGCACCAAATTGGATCAGAGGTCTATGCAGCAAATATAATACATAAAGCTACAAACTGTACATTCCTCCCTCCCAGCC
ACACACGCGGAATCCGCAGGGACCTCCACGATGCCAAGAGGCAAGAAACCGTCTGGTGAGGAGATTGAACGGGTAAAAGCGCACTATAAGGATGGAAAAG
CAAGCGCTGGATAGCACGAGAGATTGACCGAAGTCCGAACGCTGTCTGCAACGTAATGAAAGCTCCTAATCGTGCAAAACTTCACAAACGACTCGGAAGG
CGACCATATCCGACCAAGAGCCTGGTCCGACAAGTTGTTCGACTCGTTACTGTAAAACAACTATCGTCTAAGCGTATTTCGGAGGCGATTGGTCAGGTTC
TACGACCCAGTACCGTCCGTAAGATACTAAGCTCAACAAAAATTGCCAAGTGGATCAAGCGGAAACCGGCTCCGGCCATCAAGCCTCATCACAAGGTGGC
TCGGGCGGCCTTTGCCGCCAAATTCCTGAGTAAACCGCGCATCTGGCGTCGAGTAATCTTTAGTGATGAAAAGAATTTCAACTTGGATGGCCCGGACGGC
TACCCGTACTACTGGCACGGCGTCCGGAACGACCAAGAAGTCTTCTCGAAGCGGGCAAGCGGTGGAGGAAGTGTCATGGTGTGGGCGGGTATGAATCACT
ATGGGAAGACCGAGATCGCGTTCCTTGAGGGAAGGCAGAACTCTGCCTGCTACACTAGTACGCTAGATACGTACTTGGTTCCTTTCCTGGAAAACCTTCG
TCAAAAACATGGCGCTCGGATGCCTATTTTCCAGCAAGATAATGCCTCTGTTTACAAATCTAGGTTCACAAAAGCCCACATTGAGGTCCTTGGAATCAGG
AAACTAAAGTGGCCTGCCAAAAGCCCCGATTGAAATCCAATTGAGAATGTCTGGGGCCAACTAGCGTGGACGGTCTACGAAGGAGGACGTCAATTCGACA
CCAGGGACGAGTTGAAGGCTCAGATCAAACGAAGCTGGGCCGCAATTCAGCAGAGCTATCTACAAGATCTCGTCAAAGGTATGACAACGCGAATGGCGCA
AGTAGCTTTCAAAAATGGAAGTGCTATTGATAAATATAACAACTTCTAGGTGGTGTCCCAATAGATAAGAACACCCCCTAAAATGGCAATTTCACTTTAG
AATTTGCAATACGTACATTTTTTTAAAGATGGTTACTGCTACTTATTAGACATAAGGCAGTGTTTCTTGTACCGAACGACACAATCTAACTCCTCGTATT
GTGAGAACAGCTTGAAAAAATCTAGTGTCCCTATAATTAATAGCAGCACTGTACATGTACCAAGATGACTTTGAAGTCACTGTAAGGAAAAGCACCGCGC
AAATGGTCATACGATAGCTGTTGCCAGAGAGCAACGCACGTATCCCTGTACACTGTACAGTGTACAGTACTTTGAGCCAGAAATGGTGATGGGTACTGAG
TCAGAGTACCCGTCACTGAGGGGTTAGGGCCGTTCTTAGCCAAAAACAGCTCATTCAATCAAGTCTCCTGAAGCACTCAGTCCACATCAGCAACCAACCA
TCCCCTGTCAATCTATCGCCATGTCCTCCTCCTCCGTTATGTCTCCTCGTTTGCCTTCACCTACGGCACCTCCAAGAACCAATACATCTGACGGCGGCAT
TCCCGCGACTACATCGACTATTGGTGATGTCATGTACAACGGTACCGTGAATCTAGAGGAAGCCGAATCGTCATTTGGAGCTAAACAACTTCGCACAGAG
TGTTACCTTCGGCAGCTACGTATCGTTAAAAAGGGCCCGGACGCCAACGACCACAACTCAAAGTGATACATCGCAGCTATAAGCTAATATTAGATGTCAA
CCACCCCTCCTTCAACCTTAGCCACTAAGGCCATCCACTAGTTTTAAGTTTGTTCTTAGCCGAATCAAGCACAACAAGTACCATGACAGGGACTATGTGC
ACATTATTTTCAAAATAATGTGCACACTGTGCAAGTTCATGCACAGTATCTACATAGTCTCGAGATATAAACACTGCGACGATGGGAAAGTCTTATTTGT
AATAGCCATATGCAGATCAGTTTTGTGAGCAGAACAACGCCGACTTGAAGCGAAAAAGTGGGTGAAAAGAGAGTGAATGTCTTCCTTTCGAGAGCACGCG
TTTTTTCGCTAAGTTCAAGAAGAAACACAATTCGAGCCAAATCTTGGAGTCATATCAAAGAGTTATATATTATATGAATGCTACCAGAGCTCTACCCTGA
CTATCCTGAGGCATCACTAGTTGCACCTCCAGCAGCAGCAGAATCATGAATCGCGAGGAGATTGTGGCAGAGGTATCTGTAACGAAAGAACTGCATTGCT
GGTCTGGTGTTTCCTTCGACACCGTGTGGCCGTTCGTCACCAAGACGTGCCTCCAAAAACAGAAGAATGTAAACGCCGCAGTTGTAGTTGTCGAGTTGGG
GAATCCATTCAAACACTTCAAACCGGAAGCGCTTAGGAGAGGGTAAAGCTGGCAGCCGCGACAGGATCTCCTCCTTTAAGTACACCTTCAATTGATTGAC
GCGATCAGCCGTTTCTTGAGGATCATAGATAATCACTTGACCTGTCCGGACATTAACCAGAAAAGCACACCAGTGGTTTTGGCCGAAAAAAATTGTAGAG
AAGAAGTACAGACTCTTTGTTGGTGTCGTTGTCTCCCTCAAAGCAGCCTCCACTTTCCCCCACACATCATTGTTCTTGATCGACTCCACATCATATACCG
GAAATCTAACCACGTAGGCTGGTAGTGCAAACACTTGTGCCGTAGCTTTATTCCGTACTGATATAGTCCTTATTGTACGATCAATACAAGCACATTCCAA
CCACTTCCTACCACATAGCGTTGTCAGCGCAGCGTCTTCACTAAGCATACCCACGTCTTTGAGTCCCTTTTTCACCGCTTCCTTAGCAAGAAGATCTTTT
GTCCAGACCGAACTATCTGGCTTCCATGCATCTAAGTCAAGTGAATCGATCCATTTAATGGCTTCATCCACATCATCCATTTTGTTCCAATGCGGTGTGC
CAACAACGCATCGACTTCAGCGTCGAAACGTTATACACCGTTCGCCCCACAGAAACAGAGACACCATACTCATGCATTTGCTTTTCATGATCGCTAAACC
AACGATTCTGAAACAGCGCGACCTGTGTAATACACGTATCTAGCACTCTTAGCGGCAGCACCGTCATTATGCGCTCCTCTGCTGTTGGGGGCTTGTTTCT
CCTTCTCCCACACGGTAACCTTGGGCTTCTTCGTCTGCAAAAAAGTCAACGCACGTAGGCTAGCAGCGTATTTGCTGTATGGAGCCTTAACCCGCAACCG
CTTCAAGAAGAAGAGCTACAGAAGGGGTTTCACCATTAGCAATAGCATTCACACGCTGAGTAGTTCCTCGCATTGCTTCGCGGTTTTCCTTTCTTCTGGC
AGCTTGTGTAATCTTCGGGCGCCCTGACTTTCTTACAGTTGTCGAAATTCTCCACAGTGGCATGGTTGAAGCACGCGTCTCTTCCTTTGATTCCTCGCTT
TCCTCCTCGCGTTCATTTAACACCTCGTTGCCTTCACGGCGCTCAAAATGAGTCTGCCCAGTCTGACTCTCGTGCACATTTACTGATGGGATTACAGGCT
GAGACTGATCACCATTCTGGGAATTAGTGGAAAGGTCTCTTGAGCGAGCTGAGTTGGATGCAAGTGGTCCGCATCGACGCCTTCCATGAAGGATAGAAGA
GCGGCGCCAGTCGGTGATAGTTGCATGTCATGATTGTCGTCAACGCTGATCCCCTCATAGCTCAGTTCATCAGTGTTAATGGCGCGATCAATCTCAGATT
GGTTTCCAGTCTCAGACTGTGCATCATTATTAGCATGTGTACCACGCTCAGGATGTAAGACAGTACTGGCTTGTGAGTCACTGTCGGGCTCTGGTAAACT
TGGTGATGTACTTCGAGGATGTTCCGATTCGGGCTGTCGAAGTAACGGACAATTGCCAGCCTTCACCGCTTCTAAGACCTGGACCATGGAAGCCGTCAAG
GTAGCGTGAGCTGTGGTACCCCACTGACAACCAATTTCAGCAATTTGCTTTCCGATGACTTGCAGCTCTCTAAACTTCTCGTTCTGGCTCTTGGTACGAG
TTGTTGAGGGGGTCTTGATGTCGCGAATCTCGAAAGCTTCCTCAACGTCCTCAACAAG