Description :
From Genome Similarity Track
Location :
Scaffold_175:3204- 5331
Sequence
2127 bases(100 bases per row)
CCGGCCACATTTAGTCGATGTAGGTATTCCAACGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCCACAGT
ACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGC
AAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTG
CCCGTGAACTCCTTCAAGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACGGCTGACG
AAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTCCATCTCCACGTCCCGTGCTCCATGTTCGTGGAG
CACTTGCACTTGTGGCACGAACGCTCTCATACCCTGTTCGGCCAGGAAGCGATTCATCGCAGCTTCAAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCG
GAAGAGCATGTGGCCGTCTGGTCCACTGGCGGGACTGGATCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATC
TGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGATCCCGAGCTTTCACGTTCACAGGGACTTCCTGTCCTCGGATCCTCGCCCG
CGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTTGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGAC
GCAGCTTGGCTGATCCTCGGTGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATA
CTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCAAC
CAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAA
TCGCGTAGAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAACTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCT
TCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAA
TGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGA
GGTTTCTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCG
TCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGG
CACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGTGCCCAGACACCGACTAACGGAGGGGGTCCC
CCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAG
CTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAG
CTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCT
CCTGTGACGGGATCTTGAAAGTTGAGA