Description :
From Genome Similarity Track
Location :
Scaffold_150:3204- 4724
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_150-fgenesh-gene-0.0Dicarboxylate/amino acid:cation

Sequence
1520 bases(100 bases per row)
GCTGTCCAAGTCGGGAGGCAACACTCCGAGCCGGTTCGTGCGGCGCCCGTACGAGGATGACATGATCTACCCCGACGAAGAGGAGGGCCGCTTGAGTTTC
CTGAAGAAGCCGACGACTCAGATTATTATTAGTGTCGTCCTCGGCACTGCGCTCGGCGCTTTGCTCGCGAACCTCAAAGTCTCGGATGATATCAGTACGC
TCGTGAACCTTCCTGGCCGAGTCTTCTTGCGCGTGCTCAAATGCTTCGTGATTCCGATGGTGTTTGCGAGTCTCTCGACGGGTGTCGCGAACATCGTGCT
GCTGGGCAAAGTGTCGACGATCGGGACGCGCACGGCACTGTTCTTCATCCTCTTCTCGGCACTGGCGTCGCTACTGTCGCTCGCGGTCGCAATGGTGCTG
AGAAGTCTTCACAAAGACTCGGTGTACCTGCCCAAGACCGCGGAGATTGCGTGGTTCAACGTCAAATGCGACAACGGCAAGTACCTGGAGATGACGGCCA
CCGAGACGCTCGAGTGCAGTGCCCCCGCAATGAACACCTCGACGCTCTTCCAGTTGGACGACCTCGAGTTCGCGCTCACCTCGTCCGGAACGACCACGAA
GATCACTGTCGCTGATCAGCTCTCGGGGATCCTCAACTCGCTCTTCCCGAAGAACGTCTTCAGCAGCTTTGTCGACGGCGTGCTGCTCAGCGTCATCACG
TTCTCAATCGCATTCGGCGCCGCCGCCACGCGCGCGACGTCCCGCGAGAACAGTCCGCTGCTCGACGTGCTCAACCAGATGAACAAGATTTTCTACTTCA
TCATCACGCGCGTGATCGACTGGAGTCCGCTCGCAGTGCTCTCGCTGATCGCCGGTTCTCTTGCCAGCCAGGACTCGCTCAACGACGCTGTAACCCACGT
CGGCATCCTCGTGCTCTGCAACCTCATCACGGTGATCTTGTTCGAGCTCGTGTTCTTCCCGACCGTTATATTCTTCCTCACCCGCAAGAACCCGTTCAAA
TACATGCGTATGATGCTCCCCGCGGCGACGTTCGCGTTCGGGAGCGCGTCGTCTCTCGCGACGCTGCCGATCTCGATCCGCTGCGTCGAGTCAACTCGCG
AGGTGTCGCGCGGGCTCCTGCACTTCGTGATCACGATCGGCTCGACCGTCCACATGAATGGCACTGCCATGTTCTTCCCAAACGCGGTCGTGTTCCTGGC
AAAGACGTCCATCTCGCCGATCGAGCTCGGCTGGGTGCAGCTCTTCCTCATCTGGCTCGTGTCGCTGCTGGGCTCGATCGGTGTCGCGCCGATCCCGAAC
GCCGGCCTCGTCATGGTCTATTCGATCTGGAGCACGATCTTCCCGAACGAGGAGATGCCGCTCTCGTACAGCTACCTCGTCGCGATCTACTGGTACATCG
ACCGCATGAACACTATGTGCAACGTCCTCGGCGACATGTACGTCGCGCGCATCATCGCCGAGCAGGTCGACGAGGCCTACGAGACGACGCTCCAGGACGA
ACAAGACGACAACAGCGGCG