Description :
From Genome Similarity Track
Location :
Scaffold_2211:3204- 4272
Sequence
1068 bases(100 bases per row)
TCTGAATCAATTGTCGATGCGCGCAAAGCATCGCCCACTCCCCAATTTGCCCAGCCTTCAAGACTATACtgtcaagcagcagcacaaaggAAACACCATG
TTCGGTCGTCCGCACTCGCCCCTGCACAGCCCAccgcaccaccaccacggtCCACCgccacaccaccacaaccCTCCTCCGCCAGACCACCGCGGACCCC
CTCCGCCGCGTAGCTGGTAAGCAGTGTAGAGTTACAACAAGCTGCAAGCAGAAGATAAACCAAAACACGTCAACCTGAGGGCGACTTCGAGCACCGCTTT
GCTAACATAAAatatactacagtagtaagTGAATTGCACCAGTAGCCTTCATCGTGCTCATCATTTTAGCTTGATTGTCATTCACTCCACAAAGGACTCT
ATCGTAGCAGTAGGACACCAACGGAGACCATGATGGTAGCGTCGTTGAAGCGCGCTCTGACGTCATGCTCCAGTAGATCAGATTTAGATCAGGTCGTGCG
CACAAAAGCGTCAGTCTCTGCGCTTGCTGGCACGTCGCATGACCATCTCGCTCTTGGTGCTGCGTGTCCAGCCTGCGACGCGCAGCATCGGGGTAGCGAA
ATGATCTGGCGGAAGCGAGCTGGAGGGATCTTGCCTCCAGCTCGCTTCTGTCAGATCATTTCGCTATTAGGCTGAACAGCAGAGATCACAATGCATTTCG
CCGCGCTGAGCACACGATACTTCAAGAAACGGCTCGTAAAAACTCAACTTCGCGCAGCACCATGTATCGCGGATACCCAGGATCGCCGCACGGAAGACAC
TCTCCGCCACCCCCAATGGAGTACCCGCCCCCAGGTCCGCCTCCGTACGGATATGGTCCCTGGCCAGGCTGTCCTCCGCCAGTGTATGCGCCGCCCCCGC
CGCCTCCGAGGCCGTTCTCGCCTCCCCACGTGCACCATGGACCCCCGCCCCCGGTCTTCTATGAGGGCCCCCCACCGGGGCCAGGTTATGGACCCCCTCC
ATGCTTGCCGCcgcaccatcaccaccaccaccacccgcCCCCAGGATGGTAAACGTGTTATAGCGGCC