Description :
From Genome Similarity Track
Location :
Scaffold_46:320308- 322451
Transcript NameFunction/comments
Physo_136525hypothetical protein

Sequence
2143 bases(100 bases per row)
TCCAACAAGTACGCATCGCCCGTAGCGACTTCTGGGTCGCGAGCGGACGCAAAGTTCTTCACTAGCACGTTGAGCAGTCGAAGCCCCACGCACTGGAACA
TAAGAAGCTCATCGCCTTCGGCCGATGTTGTGGTGACGTGGCATGCGAGAGTGACGAACTCGTCCAGATACATACACAGGAAGTTTCCTATGTTGGACTC
GGTGGAGATTGGCGAGGCTGCTCCAGCAGAAAGCATCTCGAAGAAGTAGCGACGTGCCGCGACAAGATCAAAATGGAACTGCTTTGTTTGGGGTACGCCG
GTGGTCATAGGCTGCACTACCGCCATGAGCTCGAATACTCGCAGCACACATTCCACAGCGAAGTGGCGTACTTGCCTCGAAAGCGGAGGCATCAACGCAA
TGAGTTCACCAACACTTGCCTTCGTTGCTCGCCACGTATCCACTTGAGCAGCAACAGCAGCAGACGCAAGCGAGTTGGCGTCTGCCTTGGGTAAATCCAG
AGTTGGGTTTGGTGACCATGACGATGTATCATCATCTCCTGAAGCCTCGTCGTTTCCGGTTGCCTGAATACCAGGATTCATGCCCTTCGGACTCATCATC
AGCTGCTCTGCATTAGCTCCCGCAAAGGTGCTTGCAGACTCACCAATGGCAATACTGCGACACAATAGAGCCCACAGACACGGCTCAGCACCTTCGTGAT
CCCTGCCTTCTACCTCAAGAAGCGCCAGTGCTGTGATTTGGAGAGCGCTAATACCATTCCGTTGCATGATAGCAGAGTCGGCAACAGTGAAGGATAGCAC
GTCCCACATTCCATGCAATCCGGGCAAATAACTCCACATCAACTCATTGTATTCGACGTGGAGTGCCGAAAAGAGAAGACAAAACAGGTTCTGACGGCGA
ATCAATGTCGGGTCCCTTTCCACCAGCGTACGGATGCAAGACAGTCCGACATTTTGCAAGATGCTGCGACTCCACCCATTCGTGAAGACGCCCACGTTAA
CGAGACCGATTTGCTCGAATGGCTCTCCGTAGGCCCCCAAAGTCCCCATCGAAGGACCGGAACTTGATGGGGGCGACAAAACTGCCGTCCCAGAGCTCTG
TGGCGATGCCAAGGACAACGACACTGCCGAGTTTAATAAGGCAGTGTCAGAAATGATGCGCAGAATATACCTCAAATCAGCAGACTGGAACCGGAAGGGC
GCAAACACGACCACTTGCTCCAGGAATCTCAAAAACTCCAACTCGACGCGTGCATCACCATCCTGGCGAAGAAGCATCCAGTACGAGTAAAATTCGTTCA
AACGATCACTCGGGCCACCCAGCTCAGGGCCGAGCGTGGCCACCACATCGTTAATAATTCGTCCAAGCGCAACCTTTGTGCTGATTTGCCAGCGCAGACC
TCGCTTGTTGGCTTTAGAATAAACAAACCCAGCCAATACATGGGCTTCCATGAGAGAAAGGGTCGAGTTCACAAAGTGTTCGTAATCGCCTCCAGTGGAA
TTGACAGACTCCAAAATAATGCTCCACGAATGCAAAATCCACGTGCGCAACGGTTGCGAGCACTCCCCAGCAAACCGAAAGATAAGTCCTGTGTCGATAG
AGATGCGAGACCCGCACACGCGCTTCATGCAGGTCAATGCAAAAGCTGCGCCGGCTGACAATGTCGATACGTCCAGGTCAGCGTTGGAGCCGTAGGTAGC
GTTTGAAGCCCCCTGTGGAAGCTTATCCACTACCAAGCGCTTTTCCAACTCGATAATCAACCCCTTGCAATGATCTTCGCCAAGCAGCAATGCCAGCGTT
CCGAGCGCTTCACCGGCACCGCGACGGACCTCCGCGTTTTCACTTGAAATCATTTCACAAAGCATAGTCTGCATTTGAAGAGGCCACGACGTAGCAGAGA
GCGATGCCGTTGAAGTTAGCGCGGCACCAGATTTGTCGAGACGCCTGGCCTCTGCGATCACAGCAAACAACAGGGAACACACATTGACTTCGCAGTCCGC
GCGCACGTCAGTTAGCACGCCTGCGTAATGTTGCAGACACCGAAGCTGTAGGTCTTCTGGGATGTTATGGAACAGCCGACCAAACAAAAGAACGCTCGTA
TCCACAAGGCGAACGTAAGTGAATGGGCTGCAGCTTGCACGTT