Description :
From Genome Similarity Track
Location :
Scaffold_92:3203- 6108
Sequence
2905 bases(100 bases per row)
TGTGTCCAAGGTGGCACAGATGCGAGCGTGAAGTCGATGAAACGCTGGACAATTAATGCTGCGACGGCCAAGTCTCACCTGCGCGGATGAAGTCCGAAAG
CGACCGGATACCGAAGATGCGGGACACATGGAGCCTAAAACTGCGTTGCGGCTCAACGGCCATACCGATGCAACGCCGATGTGGAGAAATGGTCTCCCTT
CGAGGTGATTGCTCGTAATGAAGAGTCCGGTCGGCGTGAAACCATATCGGTTGACGAAGGCCGTACCAAGCGCGGTCATCCGAAGGAAGGTCATGCCACG
TGATCTCCCATCGAAGGGAGTACCACAATTTCCACGTCACCTTCCACCACTCATTAGCCAGCCTCCACTTGATCATATCTCCATGTCGAAGTGGGGAGAT
AGTGAGAAAGTCCAAGGCGTGCCGCCGACCAGTAGGTGGGATGAACCTCAGAAGCAGCTCTGAGCTGGCCGTCGTCCAATCTTGTACCGATGGAGATTCT
AAACCGCGGACAAGCTGCAAAAGCAGTTGGAGACGTTGACGCTTGAGATGAGCAGCGAGATCAGGAACTCCCAACCCGCCGTCACTGCAGCGCTGGTAGA
GAAATGCGCCGGGAAGTAGCTGAACGTGGGAGGACTCGCGGTCATGTTTACGACTCAACACGAATCGGTTCAGCATCGATTGCCAACGCCGCACTGTTGT
CTTTGGAATGGACAAATGCTGGGTGTAATGCCACAACCGAGAAAGAATCATCGTCTGGGCAACCAGCAAACGACCCCGAAGTGTTCGAGCCCGTCGATAC
CAATGTTTGAAGCCATCATAGAAGCGCTGCTCAAGAAAGTCAGCGATCGCGGTATTGACCGAAGACTGTCCGAACGTGATGCCAAGGTATTTCACAGTAT
CTGTCCGACCGAGCACGCGCACATCTGGTAGCAGTGGGCACTCCTTGCTCCGGTTGAGCGCGAGCAGAACGGACTTGGAAAGATTTAGCTTAGCCCCAGA
CCCGCTACAGTAGTCGTGGACAAGCCCTAGCTGATCTTGCAAGTTCACCATCGAACTGCTCAGCAAAGTGGAGTCATCAGCGAAGAAGGTACCCGTGGCA
GTGTGGTCGGCGTTCAGGCACACACCATACTCTTCGTGGGACCGTAGCAAATTTCCAAGCGGTTCGATAGTCAGGATGAAGAGAAGAGCTGACAACGGAT
CCTCCTGTTTCACACCGCGTGTCGGAAACAGCGGAGGCTGGATGTTCTGATTGATGATCAAGTGGGCCCGAGGATCTGTGTAAAGAAGCCGGACCCATTG
GGAGAACGTGGACCCAAATCCCATGCGGTCAAGAAGTCGAAACATGTAGTCCCAGTTGACCCTGTCAAAGGCTTTTTCGAAATCCAAAAACAGCGCGTAC
GCTTTCTCATCCCGACCTGTCACCAGGTCCTGAATATCCGCAAGAAAGCGCACGTGGTGATGAATTGACCGTCCCTTGACAAACCCTTTCTGGTCGGGGT
GTATTAAGTCTGAGATAACCTGTTGAAGTCGATACGACAGCGCCTTCGACAGCACTTTCACATCCACTTGCACAAGGGAAATCGGTCGGTAGTTGCCGGG
AACTGCCCGCGATCCTTTATTGTGCAACAACACAACAGCTGATTGTCTCTGGGAAGGTAGAAGTTGTCCCCGCTCAAGTCGGTCGTAAAAAACAATGCGG
AGGCACTCTCCAAATACATCTGGAGCAACCTGGTAGAAAGCAGCCGTGAACCCGTCCATACCAGAAGCCGAAGAAGCCTTCATATGGCGGATCGCATCCG
CCAAGTCCGAAGCTGTCACTGGAGCGTCCAGGATGGCACGGCTGAGCGAAGAGACCGAGCTAGTGATGGAGTTGAGAAGCGTGTGCTGGAGGGTAGCATC
CGGAGGGAGGGGTCTCCCGCTCGGACTGTCCGGGTCACCCACCTCTGAACCCCAGTGCTCGAGAAACTGGAGAGAGATATCGTGTGGGTTTGTCGAAAGC
ACACCACCCGGAGTTACCACCTCCTCAATAGAGACGCGACGCAAGCTGGTATTCAATGGCCGGAAGAAGTGCTTTGTCGACTTTTCAGAATGGCTAGCTT
GGAAGTCAAACGCAGTGTCCTGGTTGTATTGACTCGTGCGTTGAACTGCTTCCTTAAAGTACCGCATAACATCGGCATAGAGTTCCTGATGCACGACACT
AGAAGAATCGCGATAGCGAGCAGCGGCTCGATCAAGATGATTACGAGCTTCGTCAACAGCGTAGGAGTCTTGCAGACGTAACTTCTTCTGCACTGCTTGG
AGCTGTTTCTTGATCATCGTTTTCCAAGTTTCCCAGACCTTGCCTGGGTTAGAAGCCAAACGGAGGGCGTCCCGGACCAGTTCCGCTTCTGTTTCGATTG
CAGACACCACGGTGGGGTACTCAAGAAGGTAGCGAGGGAGCTTCCAGTACTCACGACCATGCAGTTGGGACCCAGATCGGAAACTCACACTGTGAGCAAG
ATGGTCGCTGGCATGTTGGGGAAGAAAGTACCGAGAATCTCCATAGACTGGTTCGAGAAGGACTCCGACATCAAGATGTAATCCAGACGGTTCTTGCGGG
GTAGAGGACCAGTAAATATTTGCTTGGGGTCGAAGTGGATCCGCCAAGCGTCAACAACACCAAGGTTGGCCTTCCATTCAAGACAGCTGGACCGACCCGG
GTCATAACGCAGGTCCGGAGTCGAGGAGTCGAGTCGAGGGTCCAGGGGAGTATTGAGATCCCCCAACACAAGATGGGTCGCTCGGTCTTCAAAGTCGACC
GGGACCAAACTCGAGAAGAATTTTTGTTTTTCCTGGCGATCCACTGGTGCGTACACGTTGTAAAGTAGAGTGGCAAACCATCAACCATCGCGCGCACGAC
AAGAT