Description :
From Genome Similarity Track
Location :
Scaffold_228:3202- 4371
Sequence
1169 bases(100 bases per row)
TCCTGGTCGCCCTCGTCCTTACTTTCGTCACCTTGCTGGCTGTATCCACTCTTGTTGTTTGACTTGTGCGGGTGGCCTTCGCTCTTACTCTCATCGTGCT
CCTGCTGGGCAGCGTGGACCGCCGATATCTCAACAATGACCCACTTGCCGCTGTATGCCATGCATCGCCGCTCGTCCGTTCGCATCGATACGCTAGCGAT
CGGCTCCAAGCTCGTAGGGAACCACTCAGCCAGCGGTGCGACCATTAAGTCTTCGTCGCCGTCCTCCTCTTGGACTTTCTGTTGTTTGCGCATTGCGGGC
ACCACTACGACAATTGGGTTGGCCTTCCAGTCGCGTCCTAGCTCACCGAGTATCTCAGTGGGCTGGAGAGGCGGCTCCTTGTTGTCGAAGGCTGTTCGGT
TGCGGTACACTTGGAGACGGACCGTTGGCATTCGCTTGGCGATCGACGGGAAGCCGTGGCGCAGTTTTGCTTGAAACTCCGCGATCGGGTCTGAACTTAG
GAGCTTTAGCGTGCTGAAGCCGTCGTCGTCTTCGTACGGGTTTCCATCCGAGTCGAGAACGTGGAACCAGACGAGGTGCTTCCCGCGGGGCAGGAAATGT
GGAGGCATAGCCATCGAACTGTGAACTAACAAAACCACAAATGAAATTCCGGAAACGAAAAGTAAAGGAAATCGTCAGCAAAATCACGTACTAGTCAGCG
GCGCCTGATGCTTGATGGGGCCAACTGTCGGACTGACGCGACTGTATCAATCATGGATTGGTGTTTTCATAAACCCATCGACCAAGGGCCATGTGAGAAG
AGCACGAGTTGACAAGCGACCATAGCCACCCATCCAATCAGATTTATAACAAATCTAAATAAACCTCTGGATATGAAATTCAGAGAACTCTTGGGACTGG
AGGACACTGCTGCTGGCACTGCTGGTGCCAGCGCCGTATCTGTTGCAGCCTCTCGAGGGGAGGGCCTGAACGTCTCGTAGAACTCAATGGCGTCGTCACA
CGCAGCTGGCTGAGCTTGAACAGCGCTAGCCAGACGCGCAGCAGCACGTGGCTGCCCTCGCAGAAGATCACGTCCCAGATGCGATGAAGAACGTGCGCAC
CCGAAGTCGATGGGCCGAAATCTGGCCGGCCACTAAGCTTGGGATTAACTGTTAGTTTCGTCTTTTCCG