Description :
From Genome Similarity Track
Location :
Scaffold_156:32017- 35228
Sequence
3211 bases(100 bases per row)
TCACCAGAAGAAGCCCCTCAATGATAGTAAGGCCTAAAGCGACCGACGTAGAACGTACGATGCGTGCGCATCTTACGTGGCAGCTCAATACGCGTTGCCT
AGGCGGCGCAGTACACGAAATGGACCGATGACTTGGGTAGTAACTTGTTACTTCCCACATTAGGCACTATGTGTCATGCTAAATTTACCGTAGATAGATG
GACTAAGTCGCCTCTATTGAATAAAAGAACATTTGGCCTTCCATTCTTGTCAGCGTTTCGTTTCTGTCGATCCATCGCCTCTGCGATAGAGTCTTGTACG
AAACGGACAACCGTTTCGCGAGACAGTATGAATTCATCTGCTGACTCGCTGTCTTTATCTGCAGTGATCTTGGCGCGTACTGTAGCAAGATCACTTGTCG
CCTCTGTGAGTGTGTCTTTGGACGCACTAGGCTTGATGCTGATTTGATCAGTATCGTGGACAGTAAGAGCATCTTCGCTCTTACTTTCGTCTTCTTCACC
AAAGCCGATGGGATTGATATCGGCGTCGAACGTGGTGATCGCATTGTCAGCACGTGATGAGTGAGAGCCGGATTGACGGCCGCTCGAAATGAGCCCCCTT
AAACGAGAATAACACTCTATAAAGTTGGGAAGACGCGGATGGCGTAAGCCATTCACGAAGAACGGCGTGTGCTTCGTCGACGCATAGACTGAATTGTTGA
TGGCGAACTCCACCATCGGCAGGAATTCGCTCCAATTCGTAAAGGAATGGACGTATCCCCGAAGGATCTCCTCGAGGACACGATTGGCACGTTCGGTCTG
ACCATCTATTTCAGGATGGTCAGATGTGGACATCTTTAAGCGCGTTCCGAGTATTTTGAACAAGAAACGCCAGAACTCAGCTGTGAACCGCGGGTCCCGA
TCGGACAAGAGTTCACGAGGCAACCTATGAAGGCGAAAGACCGTTTCGATAAAGACACGGGCACAAGCCGATGCGTTGATTGATTCGGGTACAGCAACTA
GATGTACCATCTTGCTAAACCTGTAAACGAACACAAGAATACCAGTATTCTTTTTTTGTGAGAGTCTGCAGGGAATCCAAAGACAAAATCCAGTGAGACG
GATTCCCAGCACTCGGCCAGGACGGGCAGAGCCTGCAACGAGGCTAAAAGGGAAGGACTAGAATTCACCCGTTGACAGACATCACAGGCCCGAACGTACT
TGCGCACGAACTGATACTGGCGGGGCCAGTAAAAGTCGCGGCTCATTGTGAAATATGTTTTCTCACGACCACGATTTCCACCAACAGGTACGCCGTGGTA
CTCATACATGATACGCAATCGCAAATCATCATGATCTGGTACGACGACACGAGGCGTGTCACCGGCAACAGCCGAATATTAAAGTAAGCCGTTGCGAAAT
GTATATCTAGCCGTAGAGGATAGATATACTGACGACGACTGTTTGAGGCTCTTTTCAGATGGGTGCGAGTGATGATGCATCAATCGAACCATTCCCGTCA
TACGCCTTTCGTATGTCTTCCAATAAGGCTGACGACGGGACACTCGAAGTCAGTACCGCGACAGTGGTCGGACCAGTGTTGGGTGGCGCAGCCAGCTCAA
AATCAGGCCGGCGCGAGAGTGCGTCAGCGACGACGTTAAGTCGTTCTGGCTTATACTCGAGAGAGAAGTTATACTCCGCAAAAAATGACAGCCACCTCGC
CATCCGCTGCAAGAGGTGTGGACTGTTTACGGACGCGTAAAGACGCATGATCAGTATAAACGATGAAGGGTCTATCACCTAGCAGATAGACTTGTCATGG
ATGGGGTAGTTGCGTTCAGCTGGTTGCAGCTGGCGTGACTAGTAACAGGCGACACGCTCCGCATGGTCTGCATCGTACTGCATTAATGCACAGCCGATTG
CAAAGTCGCTGGCATCACAGACCATGTGGAATTGCCTGTCTTGGTCTGCAATTGTCAAAACTGGCAATCGTATCAAGATTTGCTTGATACCTTCGAAAGA
GCTCTGGCAGTCGGCACTCCATTCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAACAGTCATCTCGGCGTAATTGCGTGAATATTTGTGCGAA
TACGCCGCTAGGCCAAGGAACTTTCGAAGTCTCTTGACATCTGTAGGCACCGGTTAATTGGTGATCGCCTTGATCTTTCCTGGATCGGGCTGGACGCCAT
GCTTGCCCACAATGCAACCAAGAAGTGGTATTTCGCTAGCAGCAAATATACACTTCCTGAGATTGGCGTACAACTTATGCTCGCGCATTAGTGTAAGAAA
TTTCCGGACGTGGAGTCGGTGCACTTCCACATCCTTCTGTCCATCCATAGCCCGGCTATGGACGAACACATCATCAAAGTAACTGGGCGCGAATTCTCTT
ACTGATCTTAACAGATTCGTTACACATCTTTTGAATGTGGCAGGGGCATTACTTAGCCCTTGTGGCATTACTAACCACTCCCAAAGCATACCGCTTGGGG
TGCTCACTGCAGCATAGGGAATGTCCCTTTCGCGCATAAGGATCTGATAGAACCCATCCATCAGACCCATGGATGAAAAGATGGTACTCTTAGCCATACC
ATCTATGATGACATCTTTCCTTGGTATTGGTGTTTGAGCCATTACAGTGGCAGCATTCAAGTTGTTGAAGGCGTGTACTATCCGCAACCCTCCTGTGGCC
TTTCGCACACAGAAGGTCGGAGAGCTATGTGGAGAGGTGGACTCCCTCACACGGCCTGCTGCTAAGCGATCTGCAAAGAATTTATCGATCGCTAGTACTT
GTTCACAAGGCAGTGGACACTGCTTCATGACCCAGTACTTCGAACCCGGTTTCAGGTTGATTTCTTGACGAGTACCTTTGTCCTTAGGTAACTCGCATGG
GACTGCTTCTGGGAATACATCCCTGACTTCCATCAAATCATCATAGAGAGGATTTATTCTGAGAGATTCCAACGATTGGGATGTATATCGCTCAATTCGA
GTCTTCTCATCAAGGACACCCTCGTCCATTGATGAGCTACTGAGAACTCGTTCATCTTCGGCAAAGACCATTGCCGATTGGATATCACTGTCGTACACAT
CTTCCGCGACGAGTACGCAGATCCGCTTGACTTTGCCTCTACTCAGATCACGCAAGAACCTCTTTTGGTTCATCGGGGGTAACTGAGTGATCTCCGAAGT
TAATTTTGGAG