Description :
From Genome Similarity Track
Location :
Scaffold_532:3201- 4977
Transcript NameFunction/comments
Phyag_g6428hypothetical protein

Sequence
1776 bases(100 bases per row)
ACCTTCGGCTTGCTGGGGATTCCGTTAGTGTTGATGATCCTAGTCTCTATCGTCTGGACCGCGTGGCTGATTGTCTTGACTATTGCACCCAATCAAACTG
CGAATTACCTCATGGGCACTACTCCattcgacgatggcgattTCTGGTTGATCATCGATCCTGAGCCTGTTTTCATGACTGTAAGTGCACTGTGTCTTGG
CGTATTGTTGATTAGCTACGCAAATGTGGTGCTCAAGATGACGGTGAGAAGAAATGCCAAGTGTTCAACAAACCTAGCGTACCGAGTTCTCGTCTCAAGA
CTTTACCGTATGAGCAAAGCGATCAGCCCACGGCTGCGGCTTGCACGGAAATCGTTTAAGCTCTGGAACGAGTTGAACAACTTCGATGGGCGCAGACGAA
AAATCTTTGTACGAACATTGGTTTGGGGTCGCGGTTGAAACTTAACGCTTTGTGTCTTTGTGTTCCTGCAGAATGCTTGTCACAAGTCATTGGATTTGTC
GATCCAGATAGCTGCGCTATATCGGCTTCTTGAAGACGGTATCCCCTCCAAATTGTGCTACGTATATGCGTCACTGGTCGCTGCCAATTCTCTTTTCTGT
GCGGCTTTGATCCTGTTTCCTTCCTCCCACTCGGCATTTTTCGAAGTCTTCGTCGACACAATGTAAGTTTTTCTTACTGTTCATGTTGTACGTTTTCTCT
AAAATTCGTGGACATTGTAGATTCGACATGCTCTTTGCGGTCGGTTGGCCTATTTGGTGGCTTTGGTATTCCTACACTGGCTTTAACTTCGATCGCGCAA
AGGCTCTACTGTATTTGGCCATATATCCCGAAGCATGGTATGAGCGTCAAGCACGGCGCATGGCAAACTCCTCGGAGGTGACGCATTTCATGATCAGTTT
TGATGCTTTACGCATGAAGTCCGGCTTGGATCTGTGTCTCCGCATGGCGATGAACTTTTCTTTCAGTCATCGTCTCAGTCGCGTCGTGCAGTTCATGATC
CGACGACAAAAAATTGAAGTTGCCTCGAAGAGGTCACCAAAGGGAGCAAATAAGCAGCTTCACATTCAGCGACCGACTGCACTGATATTCGTGTTTGCAA
GCGTCGGTGTCCTAGTGCACACGCATGAAAGCATCGTCTTTTCGGGTACCGTGTGTGCAGTATACCCAGAATGTGTGGCCTACGCCTATCGATGGTCTAA
GGGTGAGTCCTGCCCGTGTCGTGCATTGGTCAACGTCGATAAAGGCCCTCGGACATACGCAGAATGGATTTATCCTccggatgctgcagcaaatatgaag
aagttggccacGTCAGGCGATTTACGAGTGATTGAGGTTATGAACAGACAACTTTCTGTCTTACCCGACGAATTACAACGATGCTCCGAATTGCAAAGCA
TGTACGTCACCCTTCACCGCTGTATATACATGTCGTTCGTATTGACACGTTGCAATCCAGAACATTGGCCTACACAGGTATCGAGAGCGTTCCGGCATGG
GCCGCCAGATTTACGAAACTAGAATACCTGTAAGGAAAAAGTACTTCATTCTCATACTTCCTGCACAAGCTAACTTTTTCTAACCTTCTCGATTGTGCAC
TATTGCAGAAGCATCGAGGGGCGGCCCATGGACAGAAACTTGGTCACACTACCAAACACTTTACTCGACCACATGAAGTCGTTGACATTCCTGCATCTAG
GGGTCCACCAAAGCCTGACCACGCTGTCGAGTATGGCCGGACCAACGAACCTAAAGGCCTTCTCAGTCGCTCTACT