Description :
From Genome Similarity Track
Location :
Scaffold_18:320093- 322272
Transcript NameFunction/comments
Phyca_LT153416155oligopeptidase A, putative

Sequence
2179 bases(100 bases per row)
cgtacctgtaacagccggccgcatagccgcctgcgaagatgtgtgcaaaagagcagaggaacctgtcttcctccagtggattcagcaccgcaaacttgct
cagcagtctctgctgcacctcgaacaacgattcctgcggcggcgcgtagtgcgagtgtaggtacatgtctagcgcgccgaagcccagctgacgcgacatg
cccgtggccaccatatagttacgcgccgccttgagcttcttgaagagctcgtccggcagcggttcgccagtcttaaagtgtccgctgatctcggcgatag
tgtctgtgaggtacatcaacaagtaagataccattggcaatatcaacatttgcataaaccactgacctttgtcatagcaaaagttctccatcatttgcga
cggaatctcgacagcgtcccattcgatgccgttaatgccagccacgtcaccgtactccatctgcgtcagcatgtgctgcagcccatggccgaactcgtgg
aagagcgtctctacttcacggaacgtcatgaggctcggagtttcgcttaccggcggtgactgattacagatgatataggccacgggaacgcgcttgcctc
cttgctcctcaggaccaagtaggcggctacgatccacgcatgtgttcatccaagcaccaccgttcttttccttcgggcgagagtagggatccaagaaaaa
tcgggcgataatctccttgtcgccttcggtgctacggacattgaaaaaacgaacgtccgggttccaaatctctgcctggccgtcagcggcctcgatctcc
acaccaaataaccgggacgtcagcgagaacaagccatccagcacctacacgtaagcaatattagatgtcgaactaaggtgcattggtatctcaagaaaac
aaagacgtacgcgctcaagtgggaagtatggtttgatctcttcatctgtgaaccgatacttctccgccttcagcctttcagacctgttcgcaaaatgcat
agataccgtaagttactggcagtaactacacaatgtgacgatgagagtgttgtatcaacgtaccagtagccaagatcccagggtgccaggggttctgtct
gcccgtgctgcttcgcgtactcggcaacagtattcacctcttcgtgggcaatggcaatgcacttttcacgcagatcgtggtgcatcttttccacttcttc
cacactcggcgccattttcttggttatgctcacttcggcaaacgagttgaagccaagcagctgggcaatctgcttgcggatctcgagcaattcgttgata
ataacttcgttgtcaaaggactctccactcgctcgagtcgcatacgctcggtacagggtttcacgcagagacctgtttgctgaatacttcatgaactgca
catacgacggtgggtccagcgtcacacgccacggtccattctcaggcgaggcatccgaatgaccctcgtcacgggcgctctgcgcgaacatctgcaacag
cgaaggagggaggccttccaactcatccttatcagtgatcaagatcgagtacgctttggtagcgtccagcaaattcgacgagaacttggtgctctgtagt
caacaaccaaaagtaagaatcacgatcagaatcacaatagagcatcaacgttccctgtcctaccaactcggcagcacgcagcttgagcttgttgaacttc
tccttctcttctccttccagcccaacgccactgagtgtggcactgcgcagactgagctcgatgatgcgctgctgggccagctcgagtttgttccactcgt
cgctctcgcggattgcaagatacgcgccataaagggtcttgctctgcgaagcctccgtgacggtctggatcaccagctgctgcagtttgtcgtgcacggc
gcgtagttcttccgagttgcgcacgctcataaggtggcccacgatgccccacacgcgcccaagtgcatcgccctgcacctccagtgaatctaccacatct
tgaaactgaacattcttaccaacatcgcgcagcttcttctctaaatcgtgcaggtcacgcgtgtaattagcagcggcattggtgaccgccggctcaatct
catccagctggagatgttcgaacggtggcaattggcgctcgtgcacgcaagcctctagcgaattggcagatgcagatgc