Description :
From Genome Similarity Track
Location :
Scaffold_219:3200- 4801
Sequence
1601 bases(100 bases per row)
GCTGCCGCCGAGGGGCACCGATGGATGTCGCTGCGGAACTAATGGTGTGGACAATTGCGTTGGAATAGCACGCACCGGTTGACCTGCACAACGACGTCAA
TCATTGTATAGGCAGCACGTCCACGACATCGCGATGGGATGGGCACAAGGACGAACCTGGAAACTGCCCAGGACCACCGAATCCAGGGCGTATCTGATTC
ACCATTGCGACGGGGCTGCCAAAAGTGTCCACGTATGCATAAATACTGATGATCGTGCTCCAGTATACACAACAAAACGTACCCGGACGTGAATGGGGAA
GGTCGTGTTGCTGCAGCGACTGCTGTCGACCTGCTACCGCTGACAGGGTTCTGCACTGGCTGCTGCGGTTGCTCGGTCATTTTGGTAGGGAATAGCTGGG
CTTAGAAATTCGTCGAAATTTGGATGATGTAGTTCATTTTTTTGGTGGTCAGTACATCCGAAACGGGTTGAGCCCATTTCGTAGTTTCGATCTAACTATA
GCGTCGACAGCGAAGCCAATATCATAGTGGTGGCATACTACTTTGTCCCATTTGTTTATAAATTATCATGCGTTTGGCTCGCACTTTTGACATAGCCTGA
ATTTCTAGACGAAAATAACACTAGTACAACTCATTCTGAAGCGTTTTATGCAGTTTTGGAGCCCATTTATATGCAGATACCGAAGAAATAATCAAGAATT
TGTCTGATCGTTTTTTAGAGGTTTTAGGTTTTTGACTCAGTGTCTAGTCAAAAGGTGTTGGATTCCACTTTCAGTCATCTAGAAAGCAGCATGACAATCT
AATCAACAGTTTCAATAGTAAAAGTGCAGAATTGATGTAAACAGAAGGGAGGGTTTTCATGATTATAGGGAATGGTTATCCGCACACCCACTTTTTGCTG
TCCGCACACCCCCTTCATACCGGTACTTATACATAATATCATCACTAGTTTCAGGCACTGGAACAACCACCACCGGACGGGTCAGGAAACTTTGATCCGA
CGCAACGTTTAGCAATGCTGGGGGGAGCAAACTGTCGTCGTTCGCTCAATGCATACAGTACGTTGATCTGCCACCTGTCTAGACTACGCAGATCACGACT
AAAAATGACTGATTATTTACATTTGTGTACTTGGAGCTACACCTTGCGTGGCTCTCCGGAAATCTCCGCGGCAAGTCTGGATCATAGCAATGGCCTCTCG
GATTATCAAGTCTGAACAGGGCATCGGGCTTCGTCTGGACAACTCGACATGTTCCATGCTGGGCGAGACGAGGAAACGTTGCAGAACAGTACCGGCATGC
TGGCGATATGAAAAGACCATAGATCATCTGTTTCGGGAATTTTAAAGCGCTGCAGCTCTGGGACGAACTGGTCGCGGACTGGATCGGGGAACAAGCATCC
CGCCAGCGTACGCAACAATCCTTTGATGTGAATGCAAGCGGACAAGTCTACAGTCTATCCTTGTATACAGGAATGAGAATTATCGCAGACAGGGTTCGGG
TTGATGTTTTATATGCTGAAAGAGTGTGGATAAACGTTTGGCACATCCTTACTACGATGTGCCAAACCAAGATCTGTACAGATAGGAATTCAGCTGTCTA
C