Description :
From Genome Similarity Track
Location :
Scaffold_2371:320- 2884
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_2371-abinit-gene-0.5Whole genome shotgun sequence assembly, scaffold_93, strain Mel28
Pytul_var.sporangiiferummaker-pug3_contig_2371-snap-gene-0.4Conserved gene of unknown function

Sequence
2564 bases(100 bases per row)
AATTGGAGCAACTGTGCCGGGAGCTGCAAAAGCAAAACAAGCTGATTGTGGTACGTGGCCACTTGCATTTTCGCATTCCCATTGCATGATAATGTGAAGA
AATCTGATGCCGAACTGCTTGGTTTACTAGAGTGAAAGTCGCCGAATTGCCGACGAAGAAGATCAGAAGCGGTAAGTAATGATGCAAATGGTCCCTTCCG
ATTCGTTAGAATCTGTTTCTCACTCAGTTTCTTTCCGAATGTCTTCTCATGATATTGCTTTATTCAGTCGTGAGTTGTCGACACAATTTCAGAAAACGAT
TGAAGAAGTGAGCGCGAAGATGGATCAGCAGGGAAAAGACTACGTGGCATCATTGAAAGAAAACGAAAGGTGCATTTTCAGATGTCCAGTGGATGCGTCA
TATTGCAGCTTTTGGTTCTGATGCTGTCTTGTCGTCGGTGTTGCTTGGTTGCTTTCTTCGTGTGGCAGTCTTCAACAAAAGCTGAAGAGTTTCCTCGAAC
AGTACACTGTGCGCGAAGAGCACTTCCAGAAGCAGCTCGAAGCCAAGGATCTTACGGTGCAACTCGCAGACGCAAAATTGCAGCACCAGGTAGAGATCAC
AGCACGTGAATCGGAAAAAGTGAAACTCGCGCTCGACAAAGCCAAAGAGTTTTCAGACCGCGAATTGCAGTTACAGGTAATGACTTTTATTTTCAAAAAG
TGGAATTTGTTGAAAAGTCGTAAGGCTGATGACTATGTTGTTGTGGCTTGCAGGCTCAATTGAACTCGTACTCGGAGAAATTTGATATTGTGCAGGAGAC
GTTGAATAAAAGCAACCAAATGTTCACGACATTCCGCGACGAAATGGACAAGGTTGGGCGTAAACTCTTGGCAACCTTTTTATCACAATCTTACTGACGT
TGCCCTATTTGTATGGGATAGATGGCTAAACACACGAAAAAGCTTGAGAAGGAGAACACGGCATTAAAGAAGAAATGCGCAGAGTACGACACGAACGCGA
TTGCGACGATTCAGGACAAGGTCAAAGCTGCGGAGGAAACGCAAAAGTACCTCGAGAAAATCAAGAAACTCGAAAGTCTCTGTCGCCACTTGCAAGCCGA
ACGCAACAGCATCCGCGAGGGGAAACCGCTCGTGCCTGAATCCGCCTAGACATCTTAAGCTGAAGATTTTGACGGGTGCTACAAGCGAGAAATAAACAAA
AAGACAAAAAGAAAGCAGAGCTGAATATGGCGAAAATCCCCCATCCATTGCATGGCTTCTTTAAATTTAGCCTCATTTGTGTGGTGCGCATGCGGGGGTA
TGTAATACACACGGTGAATGGATGATAAGATTTTTGTCTATTTTCGAGTTGACTGACTGACGTGAGAATGCGAGGTTTGACAGGCATCATGGAACAAGAA
GAAGACGAGTTGGTCTACCACGCGCTTTGCGACGTGTAGAAGAGCACGGCAATGACCTTGGACTTGGCTGCCGATAGCATCAGTGAGGAGCAAACTCGAC
AGCGTGCGGTTCTCCATGCGACGAAAAAGATCGGCGGCAAAGATGCACCGGTGAACTACTCATTCGAAGAGCGAGTGTTCAGCTCAAAGGACACGCCGAG
TAGCAAAGCGCTGGCCAAGCAGGAAGTGCTCGAGAGTCTCAAGTCGCGGATCTTGTCGAGTGAGAAACCCGGATGGAACATGTCAACGTCCAACTACGAC
AACATGCAGATGACTGGGAAATGCTACAAGCGGACCAACGTCAATGCTGAGGTACGTCCATCGTCATCAAATAACTTCCGCCGTCTTTACTTCATTGCAA
AATTATGAACATGTTTGCAATTGCACAGAGAAATCGCGCCAACATGTACGTCTACAACTTCCGAGCCGAGAAATTACCGAAAAAGTACCCAACGGTCAAG
CCGAAATCGAATCGTTTCAACATGGGGATCCTGGAAGTCGCGCTAAAGGACGAATACATCGGCGAGACTTTCGGTGACGAGCGAATGGCAAAGGTACCTG
AGCTTTTACTCTTTACGTGCCGTGCGCTTGCTTTGATCGAACGGCTGATGGTGCTATACGTGTTTGCATATAAAGGGGATTGGTAAACGCACTGAAGAGT
TACCAAACCATCCAGATTTACGGGACGCTGAGCCCTGGAATCTGTCGAACGAGCTCACGCCATCGACTCGAAAAGAACACGTACGTGGCATTTTTTCGTA
TATAAGCGTTGAACGACCTTGCCTCATATTCACGATGCTGAACTCTCCTGCTAGTTTGCCAAAATTGAGGCCGAGCGACTCGCCAACAGTTCAAAGTGGA
AGCAGAAAGTGGCGAGACAGCCGACGTACAAGTCCCCAGAGCAGCTGACGAAAGAGCTCAACGACAAGCTCCGGCAAGAGAAAGAGGGCGCCAGAGCAGC
ATTACATGCCACGAATAGCCACGGAATGAGCGACAGCAGCTATGCTTCGTATAGTGCCTATGCGATGATAAAATAGACGCCTGATGCTTCTTGCTCCGCG
TGACTCGTCCTTATTGTAGTTCTTCCGTATCAGACATGACGAAAAGACGCGTCGTTTCGTGTCC