Description :
From Genome Similarity Track
Location :
Scaffold_32:320- 2554
Sequence
2234 bases(100 bases per row)
TTATGTCAACATGCTGCACTAGCTGTCTAGCTGTCCATAATGGCTTGACAACACAACTTGCCGTTCCATTAACGTCTGAAAGGGTGCATGTATGAGGAAT
AACCTTAGTTGAAGGTCCATATATTTTGCCATAAGAAAAATATACCTCGAGCAGTCTGAAAAATCACATACTGCTTTGAGTCACCTATCTTCACGTCGAG
TTGTCTTAAACGAACGATGAATATCATAATAAAAACTGATTATTGACAGCCGAATAGATTCCATATCAGTGTGTTCTACAGAATCGAAGAATCGTTGGGC
ATACATAAGGCTTTTTCCATCCCCGATCGTATCTGAAAAATACGATAAGCTGGATAGTGATGAAGAGCTACTACTTCTTGATATTCTCGACATAGTTTGC
TTTTTGAAATTGCTCACTGGTAACTCTGTGTTGAGCTAAATCAAATATTGGGATATTTCTTGTCTATATTTCATAATTTGGGGATATTTTGTTTCAATAT
TTTTGATTTTGGGATATTTTGTTTCTAAACTTTTTTAAAGCAATGGCGCACGCCAAATTTTTGACAGAATAAAACTGCTTGATATTTGACATATTAAAAT
AAAGGGATTATGCTATTCAGGCAGGGCTCCGGTAATAGGGGCTGTCTGTAAAAGAAATAGGGTAACGTAAACTTTTAGTTTAGTGCGCTCCGATCAGTTT
TGTGCGCATCAATTATAATTGCCAATCAAAAAATGACTCGAGGTTTTCTCAATGCCGATAGGCCAAAATAGAAAATCTAGCATCTCGCCATTCGCTTAAA
CATGTTATATTTTTCCGTTTTTTTGGCACCTACACTATATTTCGCGTCACACACATGCATACTTGAGTGCTGAATATTGGTACTTCTAACAATTAATCAT
ATTTTCAGAAAATTCATAGTTACAAGATTTGCGTCACAAAGGGATAGGGTTGTTTTTGAGAGTAGTCAGACAAACTGACCAATAGTAAAACCAAGTGATT
GAAGCGCACTAAACTGGTCGATGGCCATTCCCGGATATCTGTCTGAGCCTGAAAGCAAACAATCACAGGAAAAAATATCAAAAATGTGCATCAGATGGTC
GGCGAAAGTGGCTATTCGGAGATTTATCCATATTTACGCCTGCTTGAATTGTGAATCAAATGTTTTTGGCCATTTTGCTTGGCCTACCGTTTTAGCGCAC
TAAACTGAAAGTTTACGATAATGTTAGTTTCACCCAACCATTTTTACTATTTCCACCCGCAGAAGTGAATTATTATTTTCACCCCCAGAAATAAAAATAC
GGTAGTTTTTGCCTTTAATCTGAGGAATAAATGTCAATGACATAGCTGGAATTGTTGAACTGGCGGTTGTAGAAAAAATATTTTCACAGTGGCCAATTTG
CCATCGACGCGGGCATAGGAACCAGCACTCCGCAACTAATTTGGCAGTACGCGGTGCAGTAAAATCCAGTGCTGTCTAAGGTCGCGGTGGGTCGCCAAGC
TGCTCAAGACCACGCGCTGCGGACGCGCCAAACAATGTACGTATTTTCCAGAAGATGGCGAATATCTAAGGGTAGAGCATACCCCTGTTTGTCTATTGGC
AGAGTCTTGATTCGAGGGATAGAGAAAACGGATGTCGCTAATCGAGCACCCACATACAGGTACTCAACTCTATAATACGCATGTCTGGTCAGCATCAATG
ATGAGTGCTACGTTGTGTGAAACGATTTTGAATTAGGTAGACAAGGTGGGTACATGATTGGGGACAAGCAAACTGTGCAAAGGCTGATTTTCTCATCTAC
TACACTATTGCAAATGTAGACCATGTGTGCTTGTGGTGCCAAACTTGTTTGCAGACACTGAACTTTAGAGTCAAGGAAGCGGATCCCTCGATATACTCGA
ACACAGACGGGTCTCGCATCTGCTTTCGTCTATTTGATACTCCGGATGGTCTCCCTTTTGGCCTAGTCTCGACTGGGTCTCTCACCGACACGCTCGAAAC
TTTTAGAGTTTCCTTGGCAATTTGGGCTCGAATGTCAATTGCTGATGTACTTGGGCAGTGTTGAAGACTTGAAGAAGCTGTGGAACTATGTTGTCAATTC
GAACATTGGATGTCGATTCTCCTGCAGCAGAAGCGCGATTGAACCTGTCCAACCACCAATGCGAGTAGAAGTCATTCAGCGTCAAAGATGCGTCGGCGTC
GGTACTTTTCTGGACAGAGTGCTTGCACGGTAGG