Description :
From Genome Similarity Track
Location :
Scaffold_2412:320- 1584
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2412-snap-gene-0.1HECT ubiquitin ligase

Sequence
1264 bases(100 bases per row)
TCGGCGTCGAGGATTGTGTACAGCGCGTTCTTCATGTCTTTCTTGGTTGTGAACAACGGCAGGTCCAAACGGTTGAAACATGAGTGGGCGCGAACGATAC
GAGTTACCGTAAAGCTGACGGCTTTCAAGGTGAACGGGCACTGGTGTCCTGCGTAGTTGGTCAACTCACTGAAGCCGCCAAGCGGGACTCGTGAGCTCCC
GGTAACAAAATGGAGCAAGCGCCTCTGGTACTCGAGCGGCATCTTTTCGACAACGTTCCAGAAATGCTTCAACGCTGGGTGCTCATGCAGCCCCGGAGTG
TACTTGCTGTTGCTCTTCCAGTCGTTGAAATCGATCTCGTCGGCGCCGCACAAGACATAGTCCAGTTCTTCCGCGTCAAAGAGAAACAACAAGTGCTGCG
GAACCACTTCGTAGAAGCCCTTCAAGAAAGCGTACAGCTGAGGAGCGACGCACTCGAAGAGCGTGTACTTGAACTTGCGCTCGATGTACTCGCGCTTGTT
GGCGTCCGTGACTGCGATGTTGCGTCCGTTTGGGACCAGATCCTCGACGACGAGCTCATCGCCCATTTGCTCCGTCACGCTGAACGTGAGTTCGAGCGAC
TCGACGTCGTCATGCTCAGTCAGCCACACTAGGTTCTTGTACAGCTCTGGGTCGAAATACTCAAGGTCCTCTACACTCACAGGAAGTCCTAAGATGATCT
TGAGTAGCGGGAGTGAGAGGTGGAAGCCCCAGAGGTTGCCCTCAAGCAGTCCACGTCCAAGAAGTCGGCCAGCGGCAAAGAAGAAGGTTAAATGGTCTGT
ACCGAGATCATTCTCCGATGCTGGGTTCAAGTAGAACGTCTGATCAGCTTTGCTCACACACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGGCGCCT
GGACTCGCGACCAGCTCACTGACCTGGCCGAACCACTCGCGCTGCATATTCTGGGAGACACAAGGATCTTCTGTGAATCGAACATCCATGCCTGATCGCA
CGTTACGCAATGGGAAGCAGCTCACGTGCTCCATCGTCTGCTCGAAAGCGAAGGCCCGAGCTACTACCAGCTTGAACACTTGAGATTTCGTAGGAGCTAG
CGCAGTAATGCTACTTGCCGTGAGCGATGCATACTTTAGCGGAAACGGTTGGGTGGAGAGCTCGATAAGCTCCTGTCGGTTCTGGATAGGATCCAACAAT
CCCCCGAGTGGGGAGGTCGCTGGGTTCGCTTTACTGGACTCGACGAGCTCCATCTTGGCGCTCG