Description :
From Genome Similarity Track
Location :
Scaffold_97:32- 4750
Transcript NameFunction/comments
Phyca_LT1534556859expressed unknown protein

Sequence
4718 bases(100 bases per row)
ccttttgatcgagtattacagctacatgtagaacaaactactcgcgaaagagctacacttcaggagattcttgccatggagatacattcaagcgcagatg
aagtgtcttcatggcagtcgcccacgatatcatcgtctgatccagtaaacagcaacgagatcgtgctgtacacatttggaatagtttttacgcagtgctt
actctgtggcggagcagacatccaagtgacttgtattcaattggcagagcgtaccgcccctcttctaaaacaaactcttggtgcaacctctgcatttgag
ggcttgactgcacttattgttctcggagttcgagaagcaagtacaccccaagttttccagtcagcaattcacttagcatatacagtgttccaggctgagg
tgacacgcgagaagaaagattcaaaggaaccggaatgccaaaatagaggtggaacaaatgatgatgtgcagttaagtttgatcgacgaagttgcctgtgc
gaattggagtttcggcctgcgtgttatcctagagcggactctcgccagtccgatttgttggtccacgaagtacactgggaaggccacacctccttctgtc
aatagggaattcctacaatttgttcggttactggtcaaccaagatgaaacacgcacgattttcttcaatgatcttcttgatttaattccaaccgacaacg
tcgaagatctaactgttgcaatgaatcgaatgcgactgctacgtctggtgttgcgcaacgatttaattcgctgccacttaacagcaaacgtgaaaatgcg
catccaaagattttgcacgaagattttagacccaccaagcgatactatgacgttgaaaatcggtgaccaaggcaaaatatctcgtttggcgtctgaatgc
ttagttgagcttgaaagacttactctggattctcaaaatctcattcgtaccaatgagttgaccaccgtccacagacacttggaagtcacgaataacccac
acaactatcattcacgttgctattctcacactcccttcttcatccaagatccactatcggacgccgaggtgacggcatttcaagagcagttacagcggta
tttctctgttgtacctcggccaaaggctctttatcggcattcgtttgtacgtgccagccgagccgatagcgaatctttccaaaagggtaacattattttc
caagggcaggttgttgatcgagaactcccaaaggaaacgtttcatcaagaactcgagagaaaaactgcgccattcgtgtttgaaatcaacaacaaggcga
tcactaagttgtcttcggtgccttcagacaagcaagaaattgtgtcaagttttgctcgttttaaaggcaccatagaacgacgtagtgattcccgaggacg
atccaacaaggtgtctccagcacaagaaaaacaaattacaccagcttccaaacctacaacaacgataaatgaccagttcgtgagaagtgttgacaatgca
gcaaataccttaccgagcgggacttctgtaaagaatttaccaacagaaacggcgcgtacttccgacattttgattgcaagtaaaactcctacaaaccaaa
tgccacgtgcaccaacgcaacaatcgacaacctcactggtaaatgattttccagtaccaattgcagctaccgaacaaaagtcgatacaactggaaaacgc
aaaacagttaaacactaatcggaacgatcgcaagaccaaaacgaaaggcaaagagaagactaaaaccagaagcaaacacaacggcaaagatccagataat
tgtgttctccaatgagctcctcaaaactagtcacgagttgagtttgtatcgccgctgattctccaaaggaagtttctggacgtaatttttcaggacaaaa
ctttcgtcaacgtcaatgcaaagtgccaacactaattgcttagtagcatcccgaaccaaggcgttctcatgtcgacccgcattgctatggagaagaaagc
gaataattctccgaggagatatatcgcaactcgcacaacagtggaatgacaatatcaaaagttttaacagagccaggagcttctggtcaggtggttgctc
atgcttgctctcgacatgtttgagaagcaggtgcatcacgaaggtgcctctagtgcgtctggatccagcaatctacataggacaattgattcgtaagtct
gtcaattttcaaaaagaaattgaatcaccttcaaaagggtaaacgtagctgcatcgcgtatggaggcctcgtgagaatcgagtctttcaaaaagagtacc
gacaatttcgacaagctatgatgcagtgcatgaatcatgtgcatgagtttagtagctcgcgagaaagtctttcaaaggcagaatactaacgtccattttt
gaagatgccatatcttggaagtatggcgatgagcttaccaggactcgaaaaaaagcacagccagcaataaaaacttgggcgttcgaatcatttaatgcgg
taatcagcgcctcaataatttctgcgtcgatcgatgcgagtgggaaatctatttggccctctcctgcatgtgaactcttaacaagctgccataatagtgt
ttccctttgttgccaatgaccagttcgtaacttgttcagcacatcgttagcgttgaatcgtcgaaattcctttcggtcattgctttctgaatgagctttc
ggcgaagaaacaagttgggaaagtctctcttcttcacgctgtctacgctgttcaagcccagcaaatttctcatatacactttccatagtcggatgtacct
ggtgtttgttttctagtagattcatcaacttgctggcttcctgttccattaaaatccatggttgtgcaaatatgccattcccagcgaatagagctagctg
cttaccaatctgaatatcagcacaaacttgctcgggtgtcttttgtactggagaattttccgtcgaaatactcacacgtggtgatttagtgacaacttgt
agcattggtacaaacgcagtcgtatcataactacaaacgtttcgttgacgaggggacggaacgcttttgctgggactttttctaggagatggaatcatag
gcaataccacatacgtgtctttcgaagcccccagcgctactaccgatgccagtccaacttgactgaaaagattgtttcgtgtttgatgacaagaatgcag
caccaaacgcaacagggtgatttcagccgcaggtcgaggcatttgaacctcttgaagttcgcacgctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnggcagtcttgccatccagaattccaccactcgc
agctgaggacgtgaaaatctccactcgagtcgccactttgaagggatgagagagaagattcacttgttcaatacgtgttgcaattcctcgattgactcga
aacaccagctcttgtggaaactcacagaacttctcagatacccacacagctcgtcgaccaccacgaagacgcgtgaggttcgtcgcaggaaaatgttcgt
cctcgctagagcaggaaacaagctccagatgaacggcttccatccttttaacgcaaaaagactaactttatcataaagtgacatacactctgtacgtctt
caagttacatttatgccatttgacagttttcagaatgatggtacaatttacgtattgaacaccactttgcaactttttattccagaaggtctcatagaat
ttataccaaaatgccgacattgagcgacgaggaacaggagctgatccagaaggaccgagaggccaatccaggctgtttctactcgacagcgctgtctcag
tcctgcaggtccatcaatggcgacagcaagtgtgagatcatcaagaagatcttccgccaatgtccgaatacgcgtaaggagctcatctcgaaccgtaagg
agatcacagaggacgaacacgggggagaagctgcagctggagactttttcaatagggagaggatggatccacgaaaagggtacgtgtatggttgcaatag
tgtcaatgtttgtgttttgggtaaatctaatgatcttttcaaattcagcggtgaacaggaattcggcaactttttccaacaacggtgagtggaaatggtt
tattataaggtggcaagtggggatttactggtggtttactgattcgtggtggattgcggcacagaggtgacgatttcgaggctcagatgagtccattcga
ctttttaagccaagaaatgctgcgtccgtttgaaggtacgtcactagctttggtggaggatattgtgatataatacttaaagtattctttttcagacttc
tttggtggtagcttactggggagaggcgattcgaacccatttgaaggacttgaggagtttgagcgaatgccgatgcgtccgccgtcgccgacgcctcacc
gaccatcacgacaagcaccatcgaacccgccgcattactcgttccagccttcccagggcagaagctcagaaggtacgttgtctggatagaatttaaaaca
atagccatttcgactaatgttctgctgtgcagagtccaacgcaaaagaacgcgtacaaggcaagagcgacatgttcgcagactactctggacgcgtggag
gaaatatagggattgctt