Description :
From Genome Similarity Track
Location :
Scaffold_1677:32- 3851
Sequence
3819 bases(100 bases per row)
GGATCTCAACCCAACGATCCTTCTGCAGGATATTTCGCGGAGTTGGATATGAAGACCGATCCACCAAGGGGCCAGTTGGCCCCGCCGAGAGCTCCACCTC
TCCGAGAGATTCGATCTCGGTAGGCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCAGGATCCCACTGACACATATCCATGCCGCCTAGGGATA
CCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACACTCGTGACCTGGAGGTATTGTGATCGACCTGGTC
CCTGGATTACGGTAGGCACCCATTTCTCGCCCCGAGTGACCCACGGTTTCTCATGTTCCACCCACTTTAACCGATCTGGCAGTTCCCAGGTCTCCCCGGG
CTCGATACAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCTACATCTCGTCAGGGAAACAA
AGTGTCCCATCCGCCAAATCCAATCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCAA
ACCAGTACACCAAACAACCTGCCAACATGATCTTGATCCGCGTTCTCCCATTCGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACT
CCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATC
TTGCCCCCTACCTTGGCTTGTCTGAACTATTTTCCTGGGGCATGGTATTTCCAGTATCCACGGGACTCCCCTGTCAGCAGATCCATGGATCCAACATCTT
CAAATCCCCGGGATCCAGTAACCTGACAAACCCTGGGTGGATCTGCAGTGATCTCATCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCTCCCA
ATAACCACGTGCCGCTCCCCTTTGTAGATCCAGGGTTGAAGAGACCTCGGATCTGGCAAACTCACCCACTTGGCGCAAACTAGAAATCTTGGCAGCTGAC
GCTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGACCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAAC
GCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGTAACATCCCTCTGTGCTTGGCAGGATCAAACCAT
TGACGGATCTGGTTGTAAAATACCTCCATCGGACACTTGCCGACGTTGTGAGTCTCGCCACAACCACGACTCACGTAGAAGCAATGATCTCTGGGATGAC
CTTTCTTGCACACTTCTCACAGACCAGATGTTTCCCAACATCCCAGATTCTGTGTGCTTCCGGGATCCGCACTGCGAACACCCTGATTTGCGCTGTCCCG
TCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCGGTCTTTGCCGTTCGATCGTTGGACGCAG
TGAGACAGACTCGACGGTAATCCCTAGGGTCGGAGCCCGAACCGTCGGATCCTGATTCAGTTCCTGCGTCGGGCGCCGTGACTTGGTGGACACGTCGAGC
TGGAGCCGTAGGCGTCGGAGCCGTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCTATAGCCCACAGTACTTCT
TCAAGCTCTTCTGTGTCTGGAAGACGTAACAGGGCCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGCAGTA
CCTCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGT
AGTATTGTCGTGCCACCGACACTCCCAATCCGCAGTACTGGGTCCGGAAACTTCGCAGCAAATCTGGTCACTTGTTCCTGGTGGATCTGCCCAGCTGCCG
ATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGTCGACTTGACCTTGCTG
ATCCGTGTTCTCGCTCGATCCTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCAC
CTGCCCCGGCTGCGGCTGTTGCTACCACCGCTGACGAAGGGGATGGGCCATCTAGATCATCTGGGTCGAACGCATCATGGGAGTTGTCTCCCTCCACTGA
CTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGAAACCGACTCATCGCAGCT
TCGAAGTGTCGCTGCAGGGTGCTCGAGGAAGTGTCGGAAGAACCTGTGGTCGTCTGGTCCACTGGCGAGTCAGGATCTGTACGGCGATTATCTTGAGCCC
GATCTGACGATAACCCCACTGGCTTCTTGCCGGTTCTGACTCGATCTTGGCTGGATTGTATCAGATCACGGGTAGGGCGTACTGGATCCTGAGTCTTTAC
GTTCACAGGGACTTCCTGTCTTCGGACCCTCGCCCGCGCTTCTAGCATGGATGCCCCGGAGGGTCTTAAAGTCATGCGTCGTGGCTCGGACGACGTGTCG
GACCCTCTTCCGCCGCGGGATTCGTAGTTCGAGGACACAGCTTGGCTGATCCTCGGTGACGACACTGGATCCATAGTACGCGACCTTTCTCCGGTGATGG
ACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGGTCCAAGTCTAGCGTGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGA
CTCCGTAAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGG
ATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAATCGCGTAGAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGAT
CCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGT
TTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATC
CGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAA
CTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTT
CTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCATCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCCA
GCTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGG
GATCTTGCTCTCTCGGTAA