Description :
From Genome Similarity Track
Location :
Scaffold_2007:32- 2207
Transcript NameFunction/comments
Phyta_totarag13986hypothetical protein

Sequence
2175 bases(100 bases per row)
GAGTAGGAGCCACAGTCATACGGCTGGGAGTACGCATACGGTAGCGACTCCCGATGCGGCACCCCGTCTACATGGGAGCGGACCCAACAACGAAGGTCTT
CCATGTCGGAGGACCGCGACCGACCCGATCGTGGAGTTCGTGAGTCTCCCAGCCCAGCGCACCCACATCATGGCGAAGGGCGCCAGGCTTGCCGgactga
gcagcagcatgtccGCGAGGGCCAAGACCCAGTGCTATCTTGAGCACCAACACTCGTTCGCGGAGGAGGCGAAGAAACAtttctcctgctgcagagccAC
AACCTGGTCCAGAGGCCCAGCCGAGGGTCTCGAAGGAGGCTCGTACGAATAATCGTGACAGGGTGCCGCCTGCCCTCCTCGACCGGAATGGAGAACTCCT
ATACCAGGTGGAGCGGATTCTCCGTGAGCGGCGTGTTTGTGGGAAGCGCGAACGCTTTGTGAAGTGGCGTGGGTACCCCACGTCCCAGAGCTCGTGGGTT
CCGATTGAAAGGCTCCAGGTTGGCTGCCCGAAGGCTATCGCCATCTGGGAACAtaagcgacagcagcttcgtaAGTAGTCCGGTGTACGGGTGCTAAAAC
AAAACGCGCAGTACCCGCGCTCGGTACGAGAACAGGACTGAACATGACGCTTCAGCCCATCTATCTCGGAGTAAAGCTGCCGTTTACTCACGAGATGGGC
GAACGTAATGTGGAGGTCGCGCTGGTCCAAGATGAAGGACAACGAGCGGACCTCCTGGCGTTCCTTGACCTCCTTGGTAGAGAAGCCCCGCAGTGAGACC
CACTGCCAGAACAGTGTCTCTGCCTGGGTCCCTGTTGTAGTGTTATCGGGTTGGACCCAGGGATAATCCCACATTGGGTAGATATCACCTTTGTTCTCCG
CCTTCGTTCAAAGGCCGCTGAATTGGGAGCTAGGAGCACGCATCAAGCAGCCTCGAGGTCGCTCGAGAACAGAGGTTCGTTCTGAACCAGGGCGCGCTCG
TAGTCGCTCTTGGTGACCCGACCTCCTACGAGCTAGCGTGGagccttgagcttctcaaAGAAAAATGGAGCACCAGAGCTCACATCGGGCGGATAATAGC
CTCGGGGGTAGACAGATCCCCCGCTCACTGATTGTGAGCTGATTGTTGTCGGCGGTATGGCGGCGGAAGCCATACGCGCGCGCGACTGAGCAACTTGAAA
TTGCTGTTTCTGCTCATCGAGATCGTAGATATCTCAAGGGGGTCGTGGATTGCCTCATCCTAGGACTCCGACGATTGGAACAAGTCGTTGAACGAGGGTC
CGCCCCCCACCGTGTCGTGGCGGGGTGACTTGGAAGCGATACGCTTCTTAGAGCTGGCTGGTTTAGCCAGCTCAGCTGCGGTTTTAACAGCCTGGCCCCG
TGTACGACCTTCAGCGAGTGTCAAGTTAATGACAGCCGCCGTGGCGTCCCCACCCTTGAGGCACTCGCCATACCGCCAGGAGACTTGGACCTGCTGTCCC
CGCCTCCACCTTGGGCGGTAGCACTTGCCTGGGGCGAACCGTGATGGGACCCGACTCGCTCTCGTCACTAGAATAGCTGATGAGTGGGATGGCAAACTCT
GGGTCGCCCCAAGACCCTGGACTGTTGTCCCGATGGACGAACTGAGGTTAGGTCTGTGGAATAGATGGTGACCTGGCGCAACGAGAGCCCGCGCTAGCAA
ACGTGGCGGTATTGGCAGGCGAATGCATCGCCACGGatgccacgacggcggcTTTCTCAAGGGCTGAGGTCTTGGCATGAGATTTGACCGCAGCTTCGTA
GCCTTATTCTTAATGTCCGCCTTAGCGCCACGAGGTCCATTGCGGACCACATTCTTGGTTCTATGGAGAACCCTGGGAGCGCTTGGCAATGTGCCTGGTG
ctctgtagcagcagcgacgctcGGCGGAAGAGCTCTGTTGCGTATCGACGAGACTCGACTGTGTGAGTGAAATGTGAGGGCTTCTTTTCACTCGCTCTGA
CTGGTCGATAAATCGAACCTAAGTGGGGGAGGATGTAATGAGGTCATATGATGAGTGATTCGTCACTCCTCCGAGGTGTGGTATTAAGTACACCACGTCG
ATGACGTAGTGGCACCGTAATCCCActgttagaagcgtcaccACACATGCAAACAGGATAGAATTTATAaattgt