Description :
From Genome Similarity Track
Location :
Scaffold_1457:32- 2177
Transcript NameFunction/comments
Phyin_T30-4PITG_22161Putative uncharacterized protein

Sequence
2145 bases(100 bases per row)
GTAAGGAGACGCCAAGTTGTTGTGGACTCGACGTAGTCACCTCCTTCCGTTCAATCACTATTGCATACGGGCATATTTCACTAAAGCGGGGATGTTCTTA
TAACTGCCGATGGACTGGCCGTACATATTACATTGCGGTCCATCTGCGTAACCTGCCTTCAGGGGTCGGCGGCAGGAGCTCGCGATATACTCAGCGTACT
TTGGAAGACTTGTTCTCCGACCGGGACAGGCCGCGTACCGTTATATATGCTCATGCGACGGCGCAGACGACGCTTGGCATGCAAGAAGATCCATAACGGA
TCATTGTTCACTTGATATTTGTATACTTAATTAGGACTTCTTATTAGGAATAGACCCGAAAGGGTAAGCTTAAATACAGAACAGAATTTCCACTCAAGCA
CACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCAGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAGCTCGAAGCTCTGTAGCGAGGGTTCATCC
GGCAAGGCCAAGAGACTTTGTGTATTGGCCCGATTATTATCGGGAGGTTTTACGTGACGGCCTTTTGTTGCCTATTTGCACGACTGGGAGTGCTTGAATT
GCCTCCCTTTTATTTCTTCCAGCCGAGTGTTGAACACTCGGTGATCTCGTAAAAGGCTTACCCCGTGCCTGGTACCCTTCCGCTGTTGGGACCACGAGGA
TTCAAAACACCTGCTAGCTTTGCTCGTGCTAGTAGCGTGTTCTTATTTTACTGGTTGGCCTATATAAGTAGTTTACAAGGTCCAGTTTGTCCCGGTGCAA
GGGCAGAACTGGGGTCTTCAGGTCCGCCCGAACGATCGTTTACTATCATAGTAGACGTATTGCTGTGGGAACATCCTAACTACATTTGTATCTAGAGTTC
ACGTGGGATTTCCAACACCACAACTGGTGCCGCGACCCGGGAACAGATTGTGACCATTGTGAACTGTTTGTATGGCCTTCCAGTTTACGAGTTTTTTCTG
GTCTTGCCATGCGTGGTCGTTACATTTTGGTCGTCTAAGGCATATTTTTCTCCGTCCCCGCAATGGTACGGAAGATGTCAAGCTCCAGTGCTGTATTGCA
GCCAGCGATAGCAATGGAAGCAGCTATGGCGACGACGGCATCCGAACATGACATGAGCCCGAGATCGAGGTTCTGTATCGACCTTGACATCACACCAATG
GAGACGAGTGAAGTCAGTGCTTCCCACTCTCCAAGCAAATTCTTCTGTCGATTCGACCCCGTGACGAGGAAAGGAAGACTGCTAATGCTGCTGTTCGTTC
GTGACGGTAGCTCGACTCTGCAGGAAATGAGTCGACTGGATGTGCTGCGCATGACACAAGAAGCGGCAAAGCTTGGAAGTGAGTCTCCTGCTAAACCGTC
TCAATACCGAAGGCCAGGAACAGGTCGGCGAGCGAGTGGACATGTACAGGCTCAACCAGGGCTAGATGGAGTCTGTGACGTCCAGGTGCGAGTATCCTTC
AAGCGGCGATGTTAAGCATTGAGCTGACTTTTGCTTTACTGTTAGCGCGTACACGCCAGAGACATTCGCAGGATGGAGAATGCGTTCTCAGCATCCAACG
AACCGTCCATTATCCTTCGCAAACAAACAATTTTCTTTAGCGCTGGTACGATAATGGAATGTCCTGTGACTATTTACTACTGCAGTATTAACCATCGCTG
CATCCCTGTAGATCCTTTGCGCGCGATCGTTCTGCGAGATGCCTGTTTGGTTTACGTTCCTGACGGAGCGGACAGTTTGATCTCCATGCTCAAGCAGGAC
TTCCTGACTAATGCACGGGACAATGCAGAGGCTCCTTTCGAGTTCAGGTAAAACATCGATCACGACTATTGAAACCCGGCATGGACAGTCACTGAAGGAT
GCTTGTCTTTATGCAGAGCGTTGGAGGCGTTGCTAGCGACACTTGCAAGATACTTTCGAGCTCAGTATGATCAGTTGTCTCCCGCTATTGTATCCGACCT
CGAGCACCTCGTTCAAGGCAACTTGGACTCACACGAGCTGGAACGTCTACGTGAGTTCAAGAACACGATGAACGAATTTGAGTCTCAGGTGGATGGAGTG
CGTCGTGTGTTGATGGAGTTGCTGGACAACGAAGAAGACCTCCGC