Description :
From Genome Similarity Track
Location :
Scaffold_77:32- 1553
Sequence
1521 bases(100 bases per row)
GCTGAGTTGACTATGTCAGTTGTGTGCTATTCCAGTAAGGAGACCGCAAAACACGAGGTATTTCTCAACTTCGGGAGCTTGATCGCGTAAGAACGCTGAC
TTGACCATGCTTGTCCAGATCCTCGCACGATCTTCATCCTTGTCTCGTCCAGTGAATTCTTTTAGATCTGCAATTCCAGACAACCGAATCCGCTGGATGT
TATGTCCTACAATTGATAGTGTATCTGTAGTTGCCATCATTAGTCACCTTAGATCGTCTTCCCCTAGATATTTGGTTTCGCAGTTGTGAGATCGGGTTTG
ACGCGATTCCACCGATTCCTTTTCAACATTGATGGTATACTTCACTGGCACCATCGTGGGACCGCCGATTGACTAGCGATCATTCGGGCTTGATCTTGCT
AATAATTCTTTATGGCCGCCTCGGAGTAAGACTTGAACTGGCTTGATACTGTCGGGTTTATGTCTGGCAGTTTAGGTCCGATCGTTGATTGCACCTCGGT
CTTGACCAGTAACATTCGCTCGCGTATGAGAGCTGTACCACTCGGTACGAGGGACATTCGTTGGATTTTAATCAAATTGTATGAGTCCACTTCTGATTCG
GCCAACGCGTACTGTGATGATCTCGTGTGATATCCTTTCGTAAGGTCGGTGATCGTGTGACTCGCTGAATCATGTCGTCCGGTGGGGGGAGCCAAATTCC
CGAACAGCGATCGCCCAGCGTAAATCACTTGACTATGATCGCATTCTTTCAGCGTCTGCGCATCAAACACCCCGGCGCTCAATTTAGCATCATCAAGTTG
CTTCATCAGGCGACGGATCGCGTCCAACTAATTCAAAGTCTCCACAGGAGCTGATACTGGACCTTGTAGCAATCCGATCAGCTTCGGCTTCAAAATCTTC
GGCACAGGATCAGTGGACAACGACGTCCTTAACACTTTCCAATAAAAATTGCTTTCGAGCTGATCCGTTTGCCATCCCTCCATTCCTGATCCGCGAGATG
GTCCAGGCACCTTTATCGTCAACCCCGACGGCTTCAAACTCTCCCTTCTTGACTTATCAGGACTGGTTTTGGATAAAATTATTTCAGTTTTTACTGTTGG
AATTTCATCCGCAGGGGTCCCCGAAAGGACACCGGGAAAGATTTGAGGTTTATCTTTTACATCGAGCGATCAATCTTCCTCTCTAACTTTCATGTCACCA
AAGTCTCTCCCAAAACTCTGAAGATCTGTAGATCCTTTTTCTTCACATGCCTGCGGCGATCTCTCTTCCGCTGACGTTTTAATCTCAGGTTCTGTCTTGA
TCTTAACATCTTCTTCACAGGACTCACGGTGATATCCCGACTTACCAGAACATCCGGGCACGCGCATCTTGTGGTAGAGTGGGATTCGCAAAATTGATGA
TGCGATCCCGACTCTTCGCTGGCGCCCAGACGACCGACTAACGGAGAGGATACTCCAATTCAGTGTAGATGTATTCCTTCCTTACCTTGTTTACCTGTCG
GTAGGGCGGGTGGAACTATTC