Description :
From Genome Similarity Track
Location :
Scaffold_3086:32- 1482
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3086-snap-gene-0.1Conserved gene of unknown function

Sequence
1450 bases(100 bases per row)
TCTTACCGGTTATACCGATACAAACATCCTATTTCTGTCGACCGCTGATTACGCTCTGAACTGCAACTGACCATGTCGCATGTCAGTACCATTTTCTTGC
ACTCCGTAACGTACTACCTTTTTAACCCAAATTTGATTGGAAACCGATGAAAATACAGTACTGTACCCACAATAGCGCTCGATAAATACCGGTATACAAA
CGGTATGAGTAGCTGCTTCTTTTTCTACCAACCCAGTCCCATCATTCCAAGAGTGTGTCTATGCAAACTCGCATCATCATTTATCATTCATTTATAGAAA
GCAGCACGAACCCGAGCAGTTAGGTATGGCGCTCCGGAACGCAAGCAGAGGCCGAGGGCTCCACAGCCACGCGTGCGTGGATCTTTACACGGAGCGCGTG
GTGCTGCCGCGCGTGGCGCTGCTGGCGTTTCTCGCAGGCGTGACGGTGCTCACGGCGCTGGGCGTGCGGTGCTGGCGGAGGCGGCGGCGAAATGCGCCCT
CTCACGCCGCAGTGGCATCGAGCGACGTGCTCTACTTTGGTAAAGACGGCGGCAGACATAGCAGCGCCAGCATGCTCTCGCAGCACGAGACGACAGTGAA
GGCGACGATTCCAATGCGGTCACCGCACATGCAGATGGACAAGTGGATGGCGTACGTCATTGGCGCGGGCATTGTGTGGACGTGTCTGATCCTGCTCGGG
TTCCAATCGTACGACTACGCGATGTCTGGTAACTCGATGTTGCTCGCACCGGTGCGACCGCGAGTCGTGTTCAGCTTTACGACGATCTCTGAGGGTGTCA
CAAAGATCCAGCCGATGCTCGACGCGCTGATCAACCAGGACGGCGAGGGATTTGATACCATCTACATTGTTGTCCCGCGCGTATATCGCAAGACACCAAT
TGAGATCCCTTCGTGGCTTGTACGAGATATGGAGAAGGATTTGAAGCGGTCGGATTTCCACGGCGTCACGTTCGCGGTCGGCGTCAGCGCGTATCACGAA
AAAGTATATCTAATCGTCATCGACACCGATTTCGGACCAGCGAGCAAGGTGCTGGGCACGCTGCTCGTGGAGCAGGACCCCGAGACGATCATCGTGTATG
GAGATGACGATCGCGTGTACCCATCGCAGCTATGCGATCGCGCACTGCACTACACGGCCAAGTACCCCAACGAAGCGATCGCGGTGCTCGGCGGCTGGAT
CGCAGCCGAGGATTCGATGTACTGCGGTCGAAGCCTCGAGGTTGGCGTGAACCGCGTCTCGTTTGTAGGAGGCGCCGGCGGTGTCGCAGTCAAGCGGCGA
TTTTTCGGCATTGGAGAGGCGACGATGCCTGCGTTTGAGATTGCGAACTTCTCTAAAGCGTGTTTCCTCGGGGACGACTACTACCTCTCGCATCTGCTGA
GCAACAACGGGGTCTCGCGCCGACTCGTGTTCGATAGCTGCTGGAACATG