Description :
From Genome Similarity Track
Location :
Scaffold_3538:32- 1463
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3538-snap-gene-0.1Zinc finger protein

Sequence
1431 bases(100 bases per row)
GAACAGACTTGACTTTTGTGTGTAGAGAGTGACAACGTCTCCGTTTGACATTTCTCAAGAACTGGGTCATACATATTCACAAAACCACGATATGTCTGCA
TGTGCATGGTGCATTGTGGCAGTTCGCTGCCGGGTTTTATAGTTTATATTTATTGAAATAATAGTTGGTGGCTGCTTGTGTGCGTTTGTGCGCAGGCTCT
AGTCATTGGGTAAAGTTCACCAAAATCTCCGATTCCGCGCTCGCGACGTGGGTGCCCAACTCCCTGAACTGCCGCAGCAATTTCGTATTGTACGACATGC
AATCCTCGAATTGGCACTGCAGCATTTGGAAAGAAGAGCAAGCCAAAGTGTTAGTCAAGCCGATCATTTCTGGTAAAGAGTTGCTGCACGCTTACCTTGT
GGTACACAAAGTGGAAGTTGGTGGTGGACTTGCGCTCGCAGTCGCTGCAATAAATAAGGGACTTGCAGTCCTGGTACTCGGGCGGCATTTGCTCCCGTTC
TAAGAGCTCGTCGATGCTTGCGAAGTACAACTCCATATCGCCCAGCGACTTAGAGCAGAGTGGGCAGATGTAATTTGTCTGATATAGAAGGAAAAGCACA
GAGAATGCGTCAATTTGGATGAGGAGTATCATGACGCCGGCATACATGATGGCTTACCAGGGTATACTCTTCGTAGCAGGACACGTGCATGCAATGGCCA
CAGGGCAGAAACATCACGGGCGTCGTGGACGTAAACATATACGAATGACAAATTGGGCAGTCGGATTCCAGCGACCGCTCCACGCATTTGTGCTTCTTGA
GACTGATGCTCATGCATGCGTTGCATCGATCGCAATGAAAGTAGTCAATGTCGAGGCCCTACACAAAGCAACATAGCAAACAATACATAAGCCAAGAATA
CACGGATTGCAAGCAAGCACAGGATATCCGATAGCTTTGAGAAGCACCAACCTTTCCGATTCGACAGATTCGGCATTTGTCGCAGTGGTAAATGTCCTTC
GTCGGGTCATCATCGAAGAACTTGCACGTGGCGCAAAAGTACCGCCCAAACACCGTTTTGCACTTTTCATTGATGCATTCGTTTGACACGGGCTGCGCAA
AATTATACAAACGAGTTCTTTAGCTGAAATCGTCTTCATCATGAATACGACAACATACTGCAATCGTTTACCTGGACTGTTTCGCACTTCATGCACGAGA
TATTTTCCGTGGCATAGCGATCGATTGCGTGGCTTTCATTTTCATCTGAAGCACCATATAGGCATCCGAATATGAACTAGTTTTAGCGGCTTGTACACAT
CGCAATCGGCACTCAAAAGCATGCAGCAAACATACCATGGCAGAATCGACATGGATACCATTTTCCACAGCATTTCGCTTGCAGTTTGCAACTTCGTCTG
ATATAGCGCAGCAGCAAGAAGAAAAACTGTG