Description :
From Genome Similarity Track
Location :
Scaffold_3420:32- 1459
Sequence
1427 bases(100 bases per row)
CCAGTGCCAATACGAAGACTGCATGTCGTACAACACGAAGCTGCTGCGGCAGTTCAAAGATTCAGACAATCAAGTTGCATGTGGTCCAGTCAGTCAGACT
CACACACTCTAGCAGCACTCAAACCTGCTAGACAAAGCGTTTAATAAACGCATAACTTGCCTAGTAAATCCACCTAGAAACTATCAACTTCTCTATTATC
GACTGTAGTAATATGGTTATGGTATGAACGACCCAGTTCTTGAGGAGTTTGACGAACGGAGTAGTCGTCGTCCTCTACACACATAGGGTCATTGGAGGTT
ATTCTCGCGCCCGAGGGGGTGACACAACGTGCCTCGGTTCTTCAACGCAGCGAGACACTTCTCAGCGCCCCAAGCATTGAAGATCCTTGCATGCGTGCCC
TGTTAAAACCCACAGCGCAACATCAAAGTGGCGACGCAGCCCATCCAGTGTCAGAATTATTCGAAATGTCAAAATGAACTGCGGTTTGGAGCTCCTCTCG
TCCAGTCTTTCATTATAGATAGTTCATTGGACAAATTATGTAAAACCTTTTGACCAATAGGGATGTGCAGTACATGTATCCACTTCAGGCTACAGACTAC
GAGCGCTGGTTCTTGTAGCACCAGAGCACGAACTCACCGACTTTGGAGCGTCTGATCGATTCATACCGACTGCGGAAGACTGGATTTTGTATGGAGTCTG
TTGATATGTACGGGGTGACGAATCCGTGCTCTGGAGGTTGAACGAATGGCGCAACATGGGAGCAGAACGCAATGTCAGCGGCAGAAAAAGAGTCGCCAGC
GAGGAAACGAGTTCCAACGGGGCCATCGCCAAGCTCCTTCTCAACACCCTTTAGTATTTCTTCAATGCGCGACCAGGATCTCTCTGCGGACTTCTCATTG
ATATTCAGTGAGCGCAACAACATGCGGGGAATGTCAGTCGTATCATTGAGCTCTGCACCAAGCCGTCAACCGGGTCTGCCATGATCCTTCTGGACATTTC
ATTATCCTGAAACAAGTTATAGTAGACTTGTAAGGCAGCGCTGGTCAGTTAAAAGCCAACACAGTCCACAAAACGCACACTTACCACAACGACGAGCATG
AGGTCCGAGCTTGGTATCGAATAATTTCTCTTGTTCTTTCGCCCTATCGTTGGGGTATAGCTCAGGATACTTTTTGGCGCAAAAGGCCATTATATCTGTG
CTGTTCGTCAAAACCACTTTGGGGGAGGACGGTAGCACTAGCAACGGCACTGAACGACCGCCCTTGGGCATCGTCGACAGGTACGCGAACAACGGGGCCC
ATTTCTCTTCAACGAAAGGAATGTCAGCAAGGTGTAGAGCCCATCGCGCCTTTTCGGCATAATTGGATGCTGGGATCGTCACGAGCGTGGCTTTGGACTC
TGGGCTCGCCAGTGAAGACAGGCAGCA