Description :
From Genome Similarity Track
Location :
Scaffold_2026:32- 1152
Sequence
1120 bases(100 bases per row)
TTACCAGCAGTGGATTCAGCACGTGAAATGGATGGTGCAAGTGGAGCTGCAACCAGGATACAAGTGTCGCCACGGCAAGCCAAGTCGAAGACACAGAAAA
AGCGGGAGAAGCGCATGAAACAGCAGGTTCTGCAACAAGAGGGAATGTAATACGGGATTACATGTAGGCCTTTGAGCCCCCCTTCAGCGGATCCTGCTTC
ACCGTTTTCGACGCTTTTTTCGCCTTGCAGATTCAAATTCCGCGATGAGATCTGGGACTTGCGACAAGTTCTCCACTGGTTCCCAGGTTTGTTTCTCCTC
GCCCACCCACTCCACAAGATATTGGATCCGCTGTTTTCGCGTTCGCTTTCCACGTAATGCCTTGACGATCTGGCCAATGCTGCCGTCCGCTAAGATTACG
TCGCTTGGCCTCGACAAGCGAGTCGGCTCCTTGTACGGCTTCAATGACGCAGTGTTGAAGACGGGATGCAGCTTGTTGCCAGCCTGGATGTTGAGCTCGT
ACGCGTGGTTATGAATCTTCCGCACCACGGTGTACGGTCCAATCCACTTGGGTCCGCACTTGGTGGAGTTGGGCAAGCCGGAGTGCTTCGGGTCCAGATT
CTTCGTGCTCAAGTAGATCCTGTCACCAACTTCGAAGATCTGCTTAACACTGTTTCGGTCGTAGACGTCGCGCATCCGTTCTTGGGCCTGAGCTAACGCT
TCGCGACAGCGTAAAAGAATCGCCGCCTGTCGCTCGTGAAACTCTGCTCCGGGTCGACTCTTGGGAACACTCTCAAGTTGCTCGGATGCAAGTTGAAGTG
GATTCAGCGGAATGTAGCCCAGCTCGTTTATTTTACGAACGGCGCAAGCTTCGTGCTGGAGTTGACAGTCGAGTTGACAGCGAACTCAGCGTTGGCGAGA
TGGACGTCCCAGTCATCTTGTAGTGGACCGACGAAGCACCGAAGATACTCTTCCCAGGTTCGGTTCATGCGCTCCGTTTGTCCGTCACCTTGAGCGCGAT
GTGCAACGGTCATGTTTAGCTTCGTCCCGATGGACTTGAAGACATGCTGCCAGAAGGTGGACATGAACTTCCTGTCGCGGTCGGAGACGATATTCGTCGG
CATGCCGTGTAACTTCCAGA