Description :
From Genome Similarity Track
Location :
Scaffold_1142:32- 1042
Sequence
1010 bases(100 bases per row)
TGGAGAAACATATCCGGAGGTTCGTCACGAAACTCAGGGACACGCGCCTCAAGACGTCGCTGCAGGGCCAGAGATTCAGGAGTATCGCTGATCTAGAGTA
CGCTCTGGAACAGGACGAAGATGTCTGGAGCCGCAGCGACCATGATGCTCCGCCACCCAGAGTTCGTGACTTTCGTGCCGACAATATTCCTCAGGGACGT
TTCAAGCCGAAGCGACAAGGACGTGCGTATGTGACTAGGGGCGATGTCTCTGACTCTGAGCCAGACGAAGACCCTGAAATTCACGCGCGTTTCCAGGAAA
TCACGGACGAACCCAGAGTTTCAGCCCGAAGTGCGAGCGCGAATTCAGGGTCAACTCGTGAGATCTCTGGAGAAGAAGCTTCTACGCCTAGCGCTGGGAG
TCTGGCGAGTATGAAGGGTGCCAAGTGGACTCAGACGCTGACGAACGAGGTCTATCGCGTGATGGATAACATGGGATGGCGTCCACCGAACGCCCAACCA
GGACCGAACGCGAACTCTGGATTCCGTTCCCCTCGCCGCGAAAACCCGAATTGGGACAAGTTCTGCGAGAAGTGCGGCAAGTGGGGGCACCCAGAGGAAA
ACTGCTGGAAAGACGTGAAGTGTGATCGCTCCCTGGAAGTGGGTCATCCGACTCACTTGTGTCGCGCGCAACCGTGCGAGAACTGTGGCAAACTGCATCT
CGGGAAACCGTGTGAAGACTGGAAGACACTGGAAGCTGTGAAAAAACTCGCCCGCCAAGGTGCACTGAAGGACATGCCGAGCCAAATCCTGGATAAACTC
CTGGATGGCGAAGCAAACTCTGGGAGGCCGTCAAACCAATAAGCCCGCTGGGTGGGGACCCAGTACGCGCCGGGCTGAAGAAGGCCCCAGAGTTATGTGT
TCTAGTGTATGTAGGCCCGGAGCTGAGAACAAGAACCCAAGATAACCAACAATGCATGACTACTTTGACTCAGGATTTCATGACTTCCCCTGAAAACCAG
CATCCTGAAC