Description :
From Genome Similarity Track
Location :
Scaffold_274:31982- 37045
Transcript NameFunction/comments
g11110.t1hypothetical protein
g11111.t1hypothetical protein

Sequence
5063 bases(100 bases per row)
TCTGACTGGAGATAAAGATTTGAAGTTCGAAGCTGAATCGAGTCCTCTTCCTCCTGCGGCCAAGGTTCTAGCAGCGTTTACGCGATCTCAGGTCGAGCGA
TCCGGATCAACTGAACCTTTGGAACCAGGCAGAACGTTGGCGCCGAATCAAGGCTCATCAAGATGGTGACGCTTTCTTCAAGCGGATACAAAGCTATCTG
AAAGGCAAGTTGGATGAAGTTTCCCGATCTGAGGTCAAGCAACTTGCCAAGTATGCGGATTGCTATATTCTGGACTCACGAGAAGTGCTGTACCGCTTGG
CTGCAGAAACTAAGGGACGCCCTCGTAACAGAGAGTCTGAGCTGAGACTAGTTGTTCCTGAAAACTTGCGTCCAGACATGTTGCACTATGTGCATGAGGA
TTTTCAAGGTGGGCATCAAGGCATAACTCGCACATATCAACGATTGTGTGCAGAGTGTTATTGGCCAGGTATGTTCGCTGATGTGGAGATTTTTGTCAAA
GAGTGCACTGATTGTGCGTCGGCCAAGGGACGACCTCCTAATTCTGGACCTTCACCTGGAAATATCGAACCTCAGCGCCCGTTTGAACTAGTGTCAAAGG
ACTTTGTCACCCATATGCCCAAATCTGAACGCGGGAATACTTTTCTGCTCCTGTTTCAGGATTCATTTTTAGGCTATGTGATGTGCAAACCCATGAGTTC
GACCACTGCCCAAGAGGTTGCTGAGGCTTACGAGGAATGTGTGTTCAGGCGTTTCGGAGCAAGTTCAATGCTGAGGCATGACCAGGATCCAAGGTTCATG
AGTGAAGTTTTTACCCGATTCCGGGAAATGCTGGGTAGCAGGCAACGAGCAACCCTAGCATATCGACCTCAAGCTAACGGCCAGCAAGAGCGGTCGGTTC
AAACGGTAATGCGAAGTGTCCGTGCTTATGTGGCTGAATCAGATCAAAGCGACTGGGACGATCACGCTGAACGTTTGATGTTTGCCCTGAACACGTCTTT
TGACGCCACCCGGTTAGATACACCATTGTACTTGGTGCATGGTTGGTATGCTCAAGGGACGGTGTCAGCGATGCTTGGACCCAAACCTTCAGGCGTCGTT
GAACGTACCGCTTACGAGTGGCGTCGGAAGTTACAACGTGACTATAGTTACGCCCCAGCCTGTGCCAAAGACCTTCAGATAAAGGCGAAACGACAGCGCT
CAGAAGCTCAGACGGAGAAATGGAAGGAGTTGTCAGAGCGTCTCAAAGCTGGTTTCAAGGTTGGCGATGCTGTATGGCTATACATCCCCAAGGTGCAGAC
TGGGTTGAGCAGGAAGTTGGCTCATATGTGGCATGGTCCGTTCAGGATAGATGAGATGCATGATGATTTCAGAGTCAAGCTGAGAGTCACCAACACTGGA
TATCGGGTCAACCCTTGGGTGCATGTGAGTCGCCTGAAACCGAGAGCTTTGTTCCTGAAACGTCCAGTTGAAGCAATCGAGTTGGACGAGGATGATGATT
TTGACACCGCTTTGTTACCCGAGGACAGCTGGGAGGCAGACAATCTGAACGACGAGTTTGAAGTTGAGAAAATTCTGGATCTGCGTTGGAATAAACGCAC
TCGAACTGCACGACGCACACGAGAGTATCTCGTGAAATGGAAGGGCTATGAAGAACCAGAATGGTTACCAGTTTCGCAACTGAGTTGTGGTGCTCTCCTG
TATGAATTCAATCAAGGAGCTAGAGCGAGAGCTCGCTTCAGGACCATGCAGGCAGGAGATGATCATCCCAGAGCATAAAGTGCCCCGAGCACTTGTGCCT
GGATGTAGACCGCTGACTTTGTGAAACGATTGAACCTGAAACGGATTTTCATATATGTACCCTGAAGTGATGAACATGCTGAACGTGAAAATGAGAGAAA
CCTGAAACCGGAATTGAAGAACGGATGACTCTGGGGCAGTTGTGACTCAGACGCGACTTTTGAAGAGAGTGTGACTTAAAAGAAATGGATTCCAGAATTG
ACAATGCTGAAATGCAGGTTGGAGTGACAAGTTCTGAAACGAGAAAAATGTATTCCTGGACGTTAAGAGTACGACACTACTACATTCAAAATAAGTAGAG
CGGAAGCAGCGTCCAGGATTTGCCGACTTGAATCGGGGCTCAGACTTCAGATTTCCGTAGTTTCTGTCTTTTCGTCATCATCCACGATCTCGTTGTCAGG
ATGTCCTGGTACGATCCAGTTGAACGCACGACGCGGAAGTGGGATAGTTCGAGCACGTAATTTCGCGGGGATATGCTTGGTTCGCTGAATCTCATTTGTT
GCTGAAACCCAAAGTGTGCGCTCAGGCTCCCGTTCGTCCACCTCCATCAACTGCTGGCGGGGAGGCTTACGTTTGCCGGTTTTATCGACGGAGGGAGGGT
CTTCCCAGATCCAGTGACAGACACGAAACGGGCCAGATTCCAGGTTCCTGAAGCAGAGTCTCGGGGAAGCCTTGAATCTTCATCAGACGCTGGACCTCAG
TGCGATGTTTCCGCATCAGCGAATCTGTTCTTGAGCGACGTCCGTCATACAAGACTTGAGACTATTCATCTTGGTCCGGGTCAATGGTGATCCAGTGAAG
CAACTCCCACCCAATCTGACTGTGGTCTTCCATGAAGGACACGAATTTCTTCAGGCCGGCCATGATTGCAGGGCCCAGCTTGGAGGCTTGGTGATAGTAG
AAGACCTTGGTGCGTTCAGCAAACATGTGTCTCCACGGGAGCTGTTTCTTGATCCAGGATCCGTTCTTCCTTTTCGGCAAGAGGCTGTCGTACAAGTCGT
AGTTCCAGCGTTCTTGAGCGTACCGAATCTCAGTCTTCTGTGGAGCGTAGTTGGGGAAACCTTGAAGCTGGGCCTCGCTCTTCTTACCGAAGAAGTATAT
CTTGATCCCGAAGTACCTGAACAACGACGTGATGTTTGGATCAACAATCTCGATCTTGCGAAGCTGCTCCAGGCTCAGATCTTGAAATGGGATATCAGCC
AGAGGAGTTGAATCTCGACTACTGAAAAGATAATTGGTCTTGGAGTTCAAAAGCGCTTTCTTGCGCGCAGATCCCGAGTGAGAATTGGAGTCCTTGGAGC
GCTTATTCTGCGAAGAACGCTGAGGGGTCGAGCGAGGCGCTGAATCTTCTGAATCAGAACTGGACAAGACGGTTAGAGATTTGGGTTTCTCCTCGAGAAC
GTCGGTCTTGAGGTATTCCACTTCAGCTTCGCCTTCAGCGTCGTCAACCTCTTCCTCCTTGTCAACAGTCTCAGGGTCGAACGGAGAGTCGCCGTCGCTG
CTACTCTGGTCCGAATTTTCAGGAATTAATTGGTCACACACCACTTCGACGAGAGGATGCCAAGGCTCAGGCTGAAGGTTTCGTGCAAACATGTGCTCCA
ATCGAGTTTCGGCGCGAAGGAAGTACATCTCAGGGACGTACTGCGTCCAAGGAGTTGAGTCCAGTTTTTCGAAATAAATCATGCTCACAAGCATGGTTAC
GAGAGGCTCATGATGGAAGACGGGGTGAACCACCTTGTTCCTGCTCACAAACTCAACTGAGGTCTCGTAAGAACACCCGGTGAGCATAGTGTAGCGAACA
TCCAATCTAAGGCCGTTCCAAACTACACCTCCCGGGAGATTCCCGCGTGCAACTTCCTCCGTCCACTCCAATTCCTCAGTTCCAGAATGAGTATACTCCA
AACACGGCAAGCGAGAACTGGGACGTAACGGGAATGAGTCCTTGAAACTGATCCAAGACTCTTTCGCTGCAGACTTGCGAGTCTTCTTCGGTCGTCGAGA
TTCAGGAGTCTGAATTGAATTTTTGGAACCCTTGGACTTGAGACCAGAGTGAGACAAATCTAAGGTCTTGGGCGGAGTTTTCAGCTGAGAGTCTTCATCG
TCATCATCTCCAGCTTTCTTGCGCTCCACCACGTAGTCCCCAGGGACGCACCTGGGATCGTCGACGGCGAGGACGTTGATGTTTGAGATCCACGATGAAG
GAGGCTTGGTCCGTTTGACGAAGTGCTCAAAGAGACCCTGACGTCGTTGCCAATTGGATGTGATTGAGACGTTTGGATCTTGGTTCAAGAAATCGGTGAA
AGACCACGAGCTCAACTTCTTCTCCATCATGTCTCGACGCAGAATTTCACACCGAGCCTCAGATGTGTTCAGTTGATCTTGGAGCTCAGTGATCTTGTCA
TCACGCTTGTTCAGTTCCAGCTGGTGCTCTTCGGGCATGGATCGGATTGAGGCTTCGAACCGCATCTCAGCATCATCCTTCTGAGCGGACATGTGTCCCA
ACTCGGATTTCCAGTATGCCTGCATGGCGGTCCACTCGCGTTCAACAGCGTCAACCCTGGAACGCAACTGGAGCATATCTTGAGTTGGTTTGTTGTTTTG
CTGGAGAAATTGGGTACGAAGATGACGATATTGCGAGAGAAGTCGTTTCAAGAACGAAACCATGTTGAAAGTTCGTTCAGCCAAGCGATCGGTCCGAACA
CCCCCAAGAGCGAAGCCATTTCTCTCTGCACTGTGAGGGCACTCAACATGCTAACGAGGTTGGAGATCGAAGGAGGCCTAGAGACAACTTTCAGAGTGTT
CTGAGCCGACCCAGGACCCAAAAGCGGTTCCAAGTCATGCATGCCAGCGCCGCTGAGGGTCTCAAGCACTTGAACAGCCTCCAAACCTCCATATCCATCA
CGAAGATGGACACCATGACGAATGGAATCCTCAGTGGCAGGAACCCCGACGAGACGCATGGGGACATCCGCATCACAATCAGGCGGAACCACCCAGTTTG
TTGGACGCTTCATCTCGAAGTCTATGTAGTCAAAGCTGGACGACGGCACGAGCTTGGAGAGCGAAAAGCGGGCGTACTCACCGCGAGTTAGCTGGCGTGG
AACCTTGTTGACGAAAGAAATCAATGCGCCAGACCGCCGATTACCGGTGCTCAGAGAGAGCGGAGTTGAATCAGAGCTCCGCCCCTTGTCATCATCCGCA
CCAGCGCTTGCCTCCGCTTTGCGCTTGGACGCGGCCTTGTCTGATGCGTCGCCAAGGTTGTCT