Description :
From Genome Similarity Track
Location :
Scaffold_150:3198- 4419
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_150-snap-gene-0.4Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_150-fgenesh-gene-0.050S ribosomal protein L13

Sequence
1221 bases(100 bases per row)
GAGCCCCGTGCCAGCAGACCGGGAAGAGGCGCTGCAGATCCTGTTTCTGCTTGGTCCGCCCAAGCCGATCGACATTTTAGCAGCGCTGTGCTGGTGGGCT
CAACGAGCACTCACACCTCCGTCATCTGGTAGGATCGAGAGCCCATTGAGCGAGTCGTCCTGGCGCAGCCACGTCGAGGGAATCGTTGGCGNNNNNNNNN
NCTTTCGTGATGAGCTCGTGCCAATGCCCGAGTTTGCCGTGAGCCCCGTGCCAGCAGACCAGGAAGAGGCGCTGCAGACCTTGTTCCTGCTGGGTCCGCC
CAAGCCAATCGAGATTTTAGCAGCGCTGTGCTGGTGGGCACAACGCGCACTCACACCTCCGTCTTCTGGTGAGATCGAGAGCCCGTTGAGCGAATCATCC
TGGCGCAAGCACGTCGAGGGAATCGTTGGCGAGCTACCGTTTGAGGACACTGCACAGTATCTTGCCGTGTTCGCGGGCGATTTGGAGATGCCGTCGTCGT
TTGGTCCCTCGACCATCGATGACGTCTCAACCGCAGAGATGCATACTCACTCTTGTGTGTGGTATCCGAGTGGGTCCGGTACGACAGTGCTGTGGCGAGA
CGACGCGTGCCAAGATGACAAATATGTGAATCCATTCCAAGTCGACTTCTCCGTATCCATCCAGTTCTTCACCCCGGAGCTGCCCAGAGCGGAATCTCCA
GTGCGCACAGACGAAGATGCTAAACTGGAGCAGAGCTGGCGATNNNNNNNNNNACTTCCGTTTGAGGACAACGCGCAATATCTTGTCGGGTTTGCGGGGG
ATATGGAGATCCCGTCGTCGTTTGGCCCCTCAACCATTGATGACGTCGCAACAGCAGAGATGTATAATCACTCGTGTGTGTGGTACCCAAGTGGGTCCGG
TACGACAGTGCNNNNNNNNNNAGAGCTGCCCGTAGTGGAATCTCCAATGCACACAGACGGAAATGCAAAACTGGAGCAGAGCTGGCGATGGATTATTTCG
TATCCAGGAGACAGCGGACCAGACCGTGGAAACCGGACGTATGCGGAGAGAAGCACATCAGTGGAGCAGGAGGGGAATAATGAGCAATGTATCGCGGAGT
TCTCGATTCTTGGCTCGCTACGTGCGTACCCGANNNNNNNNNNGCGCGGAAACCTGACGTATGCAGAGAGAACCACATCAGTGGAGAGGGAGGGGAACAA
TGAGCAATATATCGCGGCGTT