Description :
From Genome Similarity Track
Location :
Scaffold_1:31974- 33272
Transcript NameFunction/comments
Phyke_g142cyclic AMP-dependent protein kinase-like protein regulatory subunit
Phyke_g143conserved hypothetical protein

Sequence
1298 bases(100 bases per row)
ATTCGTCGGAATGGTCTGTTAAAATAGAGGTTCAATTTCTCCAATCAGTTCATCTAGTCTAAAAATAAAGACCAAAATAAAGCCAAAACGTACATTGCAA
ATGCGGGGTTGCTGCGGGGTTGTCTACCTTGCCTCCGCCTGCTCCCGCTTTATGGCGAGGCGTGGCTTCTTCCGGATAGTTGGCCTGCAAGTACTGGATG
ATGTGTACAATCGGGTTCTCTGGCTTGGCCAATAACAACGACTCCACCAGGTTGATGAACAGCGTGTTGATGCCCTTCTTGTGGAGATAAtcctgcagtt
cttgttgcACGCCTTCTGCGTCCGTCATGTTGTCAAGTCTCTCAGTCTTTGAATGGATCTGAAGAGCTTTTCTTTTGGGTTCTCTGTCTCTCCTCTGCTG
CTCTGAAGACGGAACTAAACTGAGCCTGGCGCCACCTACTTTGCGCTCCAAAATGGAAGAAACTCCTGTGTCGTGTTTTCGGAAAGGAAGCGACTAGAAA
CAGCAGTCGCTGAACCCACACTCGGCCGAAAGATCGCGTTCCCGCTTGTCGCGCGCTCGACCACGTCCCGAAATAGAGCTCTGTACAACTACGTTCGTTA
CCACAACGCCTGCGTTTGTGGTCTTGGACAGAACCTGCGAGCGTGGGGTTAGTGTCGATGGCTATTTACGGCTGAACACTATTTATAGATGCCGCCTCTT
CTTAACAGCGCGACCCTTCCGGCGCTAGGCGAAATGTCGCGCTTCTCCAATTCGTACTTAATCGAAGCAATCAGATAATTTGATTATGTGCACCACATTA
ATTCACATCGCGATTCCGGCCAACCAAACTTGCACTTGCATCACAGCAACATGGCTCCGACGGCAGGTGCGTGATCTCGGCTTCTAGACCTCTTTGGACG
ATGCAACTTGTATGTTTAATAATATATGTATTTTACACTGCTGTTCTGTGCTTTTATCGTCTTAGGAACGCGTCTACGCTTCAAGAACGCGCATGTCAAG
AAACCACACCAGGCGAAGAAGGTGCCGTCTCTCAAGAACCGCATCCGTGGCCTGGAGCGCTTCCTCATGCGCGGGGTGCGTAATCTACAGAGTTGAAATA
AAGTGCTCAAGGAGTAGAGGCACTGACGAGGTACTTTGTGGACTGAGTAGGGTATTCAAGATTCCACAAGGAGAGCCAAgaaggcggagctggagcagct
aAAAGAAGAGGTGAGTGCTAGCAATGGACGGCTGCGTGAGTAGTTGCAATCTGCTATGGTTGATACTAAACTGGATGTTGTTATTGCTTGATGACTTT