Description :
From Genome Similarity Track
Location :
Scaffold_96:31971- 34301
Sequence
2330 bases(100 bases per row)
TCTGCCGGAGAGATAGTTAATCTCTCGGAGATGACGTGGGATCTGTTCCTGTCCGAACTAAAGGAAGGAAAGGTCCATGAGATAGTCTCATTAGTTCTAA
AAGAGAACTTGGTGGACTGTTGCTCTTTCGTTACAATGGACGAGAGTGTCTTGGAGACCGACACGACAAACGATTCGTTGCTCAAGGCTGTGACGCCTTG
AAACCAGTCCGTTTTACGAAGTTCTGTGGCAGCACCGTGTTGTCTTTCCTACAGAAGTGCCAAACCGCCTACCGGACGATAGGGGTATCCGGCACGAGAT
TGACTTGGAACCTGGCACCAAGTATTGTGTGACTGGCAGTGGCGGTTGCCGAAGGAACGGGTCGACTACATCGACCAGTTCTTCGACAAGAGAGCCAAGG
CGAGACATGTACGTGAGAGAAAATCGCCTCACTGAAGCCCAACCTTTCGTGTGCGTAAGGCAACAGGTGGTTGGTGCGTAGTTCATGCTTACAAGAAGTT
GAACACGGCCACCATCAAAGTGCAGACACCGATCCTGCGGAAAGATGAACTACTGAAATCAATGGGGAAGTCAACTTTCTTTTCCGCGTTGGATTAAAGA
ATGGCTACTATCAGGTACTCATGAATGAGACCGATGTAGCCAAGACGGCAGTTATCACCCGAAGCGGTATGATGTGGGAGCGGCTAGTGATGCCACAAGA
GTCGAAAACTCAGCGGCATTCAACCGGGTGGTTTCCTACGTGATGCGTCTACACCGTGCATACGCGCCTCATTACTTTGACGATGTGTTCGTTCATAGTA
AGGCCGAAGACGGATTGATTGAGATAGAATCGCACAAACGTCGTTTGGATATTGTGTTGTAGACTTTGGGCGACGCCCAATTGTACGTCAACTCGCAAAG
TGCGTAATAGGGGTCCCCAAAATACCTGTACTGGGCTGCATCATGGGTAAACACGATGTCAGAGCAGACGCAGAAAATGTCACGGCTATAAAGAAATGAC
CCCTCCCACGACATGTGAAGGGTCTGCGTCAATTCCTTGGGCATGCTAATTACTTGCACAAGTATAGCAAGAATTAGGCAAAGCGGACCAAACCAATGTC
TGAACTCCTGAAAAAGGACGCATAGTGGACTTGGTCTGAAGCCGAAGTTGATGCTTTTGCTTCGGTGAAGCAGTCACTTGTAGAGGCTCCGGTCATGGCT
TTGCCAGACGCGGATAAGCCATTTAGTGTTGTCTGCGATGAGAGTAATTTCTCTATCGGCAGTGCACTTATGCAAAAGGACGACGACGGTATTGACCGTG
TCATCTCGTATCAGTCCCGACTTTTAACAGCCGCGGAGCTGAAAAAACCCATGCACAATAAGGAGCTACTCTCTATGAAGTATGCTCTTGTTAAGTTTCG
AGTGCACCTATTGGGCACCGAACCCTTTGTAGTTTACACGGATCACGCATCATTGCGGACTGCGATAAAATCGCCGCACCTATCACCTAGGATGGTGAGG
TGGCTCACATTCTTCTCAGAATTTAATTATTGAGTTGAATACAAGCCGGGGAAGTCGAATGTTTTGGCTCAAGCGTTATCGCGCAGAACAGACTTCGAGG
AACGACACCTTGAAATGTGTCTCGTGCTAAAGCACGAAGTGAGTCATCAACACTGGCATCCCTACGGGTTGACTATGTGCAAAACAATCTGGCCTCTGAT
ATAAAGGAGGGGTACATGCAGGACGAACATTGTCGTCTGCTTATAGATCACTTTGGTGGACGAAAAGTTAACCTTTCGTCCCACCTCAAGCGAAGCTTAA
CCACTTTAGTTATAGTGACGGCCTGTTATGGCATCAACTATAACCTTGTGATCATTTGAGAATCTATGTCCCCCATGACACAGATCTCAAACAGAAGATT
CTCTACAAGCTTCATGATGCACCATCAAGTGGTCATCTGGGCCGTGAGAAGACATTCTTACGAGTGTCAGATGAATTCGGTGGCCACACCTATATAGGTG
TGGCCACTCATATTTGATCATGCGAAGAGTGTCAGCGCGTAAATCCTGCACCTTCTAGTATTGCGCCACTGAAGCCACTACCGATACCAACTCATTGTTG
GAAGTCGGTCAGTTTGAACTTCATGTTTGGCATGCCGCCTGACCATAATGCAGGACTCTCGTCGTCTTTGTTGACAGACTGAGCAAAATGGTGCATTTAA
CACCGTGTAGCACCAATATCTCAGGCAAGGAGTCAGCTTGCTTGTTCCTGGATCACGTGTATCGGCTACACGGAAATGCCCCGAGTCCATAGTTTTGGAC
CGGGATCCACGTTTTACGTCAGGATTTTGG