Description :
From Genome Similarity Track
Location :
Scaffold_6:3196438- 3198772
Transcript NameFunction/comments
Phyin_T30-4PITG_04824Putative uncharacterized protein

Sequence
2334 bases(100 bases per row)
CCGCGGCCGTGCAGAACTTCAGCTCTAGACAAATCGCCTTGGCACTCATACCCTTGGTGATCGCATCAATGACAAAGTCGAACTGCTTCACGTACACATG
GCACGGGTTTTCGGCGCCCAGCATATCACAGATCATGTCAGCGTATGCACGGACTTGACGGATGTCAGTGCCGTACTGTTGGAGCGCAATCTTGGCAACT
GTGGTAGCGAATTGGCAGTACGTGCACTGAGTCGCATTTCCAGGAGGCCACTGAGACGCCACCACCACGCCCTTCATCTCGTCAGCGATGGAAGGTTCGT
CTTCCTCCGCGTCTTGCGCCTTCTTGCAGACACCGAGAGACTTGCAGATCTCGTGAGGACGCTTGCCTTCCTTCTCCATTTCCACAATTTTGTCGAAATT
CTTGTCCACAACGTCGCATTTGAGCTTTGCAGGCACCAATTGGCATACATTCGACAGGATGTTCTTCACAATCGGCAACTTCTCTGGCGACGTGTGGTTG
ACGTGATGGATCACCACAGCCACACGCGAACAGAAGAAGCAACTGCCATGACGACAGTGAAGAGGACGCGGCGAGTGCTCGTCATCTTCCGCCATCGTTG
CGTGGTTATGACGCCCATGACGACCTCCAGGCCCCACCATCCCCACGTGGTGGTGCATACCACGAGGGCCGTTTCGCATCATACCAACACGAGGGTTCTC
GAGTTCACCGAGACTGTTTACGGGTTCCGTGATGCAGTACTTCAGCGCCTTGCAGATGTCACGAGGGTGCACACCCTTCTTCAGAGAATCGACCACAGTG
TCCAATTGGTCCACATACAAGTGGCATGGACTGTCGTCTCCCAACATGCCGCAAATCATGTCAGCGTAGTCGCGGATCTGGTCAATCTGCTCAGGAGATT
CTTGCAACATGACCTCGACGATAGTGGTGGCTACGTCGCAATACACACACGTCTTGTCCCCATTTAACGGTGAAGTATCACGCACAGGCTTCACAGCGCA
GAAACCAGTGTCCCCACAGATCTCTTGAGGGTGTTGGCCTTGCTGGACCAGCTCCATGATGCTGTCAAAGTTGGTTTCCACCTCCTTGCACTTGGATTCC
AGTGAAGCCATCTCGCATACCGCTCCTAACACAGACTTAAACATTGGAAGCTGTTGAGGGATCAGTTCATTGACTTGGTAAATGACGCCGGCCACGTGGC
TGCAGAAGAAACACGACTGGTCGTTGTCAGTGACGTCAGCGGTAACCAGAGCGCCATACTCAGCCGTCTGAGGATCTTCAGGAGACCATGGCAGGTCTAA
GACTTGGCTGTCGCTGTTGCTGTCCGACAAACACATGGCGATCCGAGCGCACACCACTAGAGGGTCAGTGCCGTGGATGAGCCAGTCCACGATGGCGTCG
TAGTTCTTGAGGAACGTGTGGCACATGGAGTCGGGTGACATGGCGTCGCACAGGTCTCCGATAATGGCTCGGACTTGCTGCACCTGCTGCACTTGCTGGG
CCAGAGCCTGGTCGATCATTTGCACAAATCTTTGGCATAATTTGCAGGACAAGTTGTCGGTTCCTTCCAGGTCCAAGACGGCCGAAATGATGTCGCACAC
TTCTTCGTCCGTCTTACCCTCCTGCAGGAACTTCCTCGCCACATCTTCCGACTTCAAGACGACGTTGCACTACAATAAGCAATTACCAATAATTTAGTAC
CTTTTCTCCTCAACAATAATTGAAGCCTCGCAAACAATAATTGTTTATTCCGCACCTGCTCCACCAAGTCCGCACGCTCGAGATCGTCGCATGACGCTTC
ACCCCAAACCTGGAGCGATACCATGTCGACAGCCGAGCGGAAGAGCTTTAAGAGCGTCTCTGTCTCGGCCTGCAGTTCGTCTTGCTCGTGAATTCTCTCC
AGTGCCTTTAGACACGCACGTTTTCGCTCTAGCGCCGGGTCTTCCTCCTCCTCAATCACGATGACGCGCACGGCGTCGTCTTGAGTCTCGTCAAGGCTAA
AGAAGCGCTGCAGTAGCTCTCCCGAGCGCTGAATTTGTTCGTTCAGAACGCCCATGAGGCCCATGGTAATGTCCTCGCTCTCTCCGTCCTGGTCGTGGTG
GCACGGCATCTCAGCCGCCTCCGGGTCGCGAATGCTGCGCTCGGCGCTCGTGACGGCCGACACAGCCGCCAGACTCACCAGCAGCGCGTGCAGGGGTCGC
ATGATTTCGTTCAATCTCCTTCTTCAAGCAGAGCGAAATCCTGTTTGAAGGGAAAAACCGTGTGACTTCCAGAGGACGGATGGCATGAGAATTGATTGTG
TGCATCGCGCCATGTCTCACTGTTTCTAAGGAAA