Description :
From Genome Similarity Track
Location :
Scaffold_7:319573- 321222
Transcript NameFunction/comments
Hyaar_Emoy2801487myosinlike protein putative

Sequence
1649 bases(100 bases per row)
TGAATCAGTCGATTCTTGTCAGCGGAGAGAGTGGAGCTGGGAAGACGGAGACCACCAAGTTTGTGATGAACTACCTCGCAACGATCTCGCAACACAAGAA
CACGTCTGCAGAAAGCAGTGTCATGAAGCAGGTCCTGTCGTCTAACCCGATTTTGGAATCGTTCGGTAACGCGCGAACTATTCGCAATGACAATAGCAGT
CGTTTTGGAAAGTTCATCAAGATGGAGTTTTCAGCGGAGGGGAGCCTTATCGGCGCTTCGATCCAGACGTACCTGCTCGAGAAAGTGCGTCTTGCCTATC
AAGCTGAGTCGGAACGGAACTACCATATTTTTTACGAGATCGTTGCTGGTGCTACTGCAGAGGAGAAGAAGCGATGGAACCTGAAAGCGTTGAATACGTT
TCACTACTTGAACCAAAGCACATGCGTCAAGCGAAAGGATGGTGTAAACGATGCGGAGCAGTTTGTAGTGTTGAAAACTGCCATGCAGACGATGGGTTTT
AATGAGGACGATATGGAGAGCATCTTCGTCACTATTTCAGCCTTGTTGCACATTGGTAACTTGGAGTTCGACGAGATCCACCAAGCGTCCGGTACGGAAG
GCTCGGAAATCTCTAGCACGTGCAACGACTCAATGAAGGTGGTACTCGACTATTTGGAGACCGACAAGCAGGGTCTGGAGCAGGCTATATGCAATCGCAA
TATTCAAACAAAAGACGAGCATTACTCGATTGGTTTGCTGCCGCGCGCTGCTGAGAACGTTCGTGATGCGCTTGCTCGTTTCTTGTACGGAAAGTTGTTC
GATTGGCTGGTCTGCCGTATCAACGATATCGTGGAAAACGACACCCGCGGCGTCCCGTTTATCGGTCTTTTGGATATTTTCGGGTTCGAAGACTTGGAGC
ACAACTCGTTTGAGCAGCTGTGTATTAATTATGCCAACGAGACTTTACAGCAGCACTTTAATTTGACTGTGCTCCGAATGGAGCAGGAGACGTACGAGAA
GGAGGAGATTCAGTGGAGCTTTATTAATTTCCCCGACAACGGTCCGTGCATTGACCTGATTCAGAGTAAACCGTTTGGCATTCTTCCGGCTCTTGATGAA
GAGTGTATTGTTCCGCAGGGTAACGATCGGAACTTTTCACGGAAGCTGTATCGCCAACACGGTGTGAATCCGCACTTTAGTGCGAGCAAGACTGAAATGG
CCAACCATTTGTTTGTCGTTCACCATTACGCAGGGGCAGTCACGTATGATACGTTTGGATTTTGCGAGAAGAACAAAGACATTTTGTACCCCGAGATCAC
CGCTATTATTGAGCGATCGTCCAAGCCGTTCGTGCGTGGGCTCTTGCAGGCTTCTTTGGAAAGCAAGGTATCGGTCCGGAAGCCGAAAGGCAGAGCCTCG
AGCAATGCAACCCGCGTGAGTTTGGGATCACAGTTTCGAAATCAGCTGAAGACGCTGCTGGAGACAATTAATGTCACTGACTGCCATTACGTGCGCTGCC
TGAAGCCAAACGATAAGGCGGAAGCCAACTTGTTGGTACCGAAGCGAGTGTGTGACCAATTGAAGGCTGGCGGTGTGCTAGAAGCTGTCCGTGTCAATCG
TGCTGGCTACCCTGTCCGTATTACCCACCAGCAGTTCATTAAGCGTTAC