Description :
From Genome Similarity Track
Location :
Scaffold_150:31947- 38378
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_150-snap-gene-0.22Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_150-fgenesh-gene-0.14Drug/Metabolite Transporter (DMT) Superfamily

Sequence
6431 bases(100 bases per row)
GCGGCGATGATGTACGAAGACCCGCTTCTGTGGGAGCAAGCCCAAGGATCGACGATCGAGCGCACCATCAAGGTCAGCGCCGAGGCGCAGAAGGTCTATG
CGCAGCAGGAGCAGATTCTCCCAGCGCTCAATCATGATCACTCCATCGATCCGGTGATAACGGAGCATTTGCACGACGTTGGACGACGCTTGCTGATTCT
ACGCGAAAGCACAAAGAGACCAAGCAAGCGAGAGCAAAAGATCCTTGAGAAGAATGCACCAAAACGAGTCATTCCAAGTCGGTATGGAGAAGAAGATGAC
GACGACGATTACAGTGACGATGCGACCGAAGACCCAGCGGTCCTTGATGGACGAATTGTGCGTGTAGTATTTGACTTTGAACTGTGGCATGGTGACGCAT
TGTGTTAACTTCATTTGCTTTGTAATGCGCTCCATGAGTAGGCGACGATGGTACTGGACCAAGAGTGGGATACGCGAACTTGGAACAAAGCCAAAATTCA
GGGAGCGATCGAGACGCTTTACAGTGAAATCGAGCATTCAGCAGACGACAAACGACGAGAGCTGGCGACAACAATGCTTATTCGTTTGCTAGAGACGCAC
GAAGGTTGTTTATCTAGAAATGGATACATCGCAGTACATTATCATTCGTTTGTGGCACTCAAACTTGCTATTCTGCCATAGATGCTGTGGATTTCGTCGA
ACAGACTACTCCAGTGCTGATGAATAAAGCGTTCCGAAACCTGTCAAAGCTGACAAACAGGGTCAAGGTTTTTCGCGTTGCTCGCCTGCTCGCTATACTC
TCCGAGTGGTTCACCCCAATCTTGTCGGTGGAAAACGCTGTAAGTTGAGGCAGCATACCAGATCTTGATGAGCATGTCACCTGTCCTAATTCATGTTTAC
TTCGTTCGGATTTAGGCAGGAAAAAGTATTCGCTGCCTGCTTCGGGAAACTGACATATGCACGCGAATCGTGCAACACCACTGGCGTGGCGTCCTTTTCG
AGCGAAGTTTGCAGAAGAAGAACTATGACTCGGGCGTTTGTGCCCGCTTACGCGCCATGCATATGGTGAAACATCTCGAGCTTCGACATCAGTTCAAGAT
TCTCCGAGAAGCGATTGGGTCCGGTGGCTTACCCACAGATGTAGTCGGCGCGTACGTGACAATCCTTTACCATTTGGCGAGAAAAAAAGGAAGCGCACAG
AGCGAGAAGGCACACAACAACATGATCGCTGATCAGAAAAAGATTGTTGGATCTGGAGCACTTGTGTTTCTGGCATCACTCATCTCAAAGACGCAAAAAC
GAGAAATCGTCGAAATGGCAAAAGAGATTGTGTTTGAAATTGCAACAAGCCAAGGTGATGACAAGATTATTGACATTCTAGTATGCAACATCGTGGATCG
AGTTGTAGAAGAACTCAAGCATTTGATGGAGCAGAAAATCGAATCGACGCACCCAGCATTCATGAGCTCCGTTAACCTCCTTGCCGTACTGTCTGAGATC
GTTCTGGCGTCCAAGCGAAGATATGAGAATTCATCGCCGAGTAAGAGCACGAGCAAAGCTGTCACTAGAACAATGAATTTAGCAGCCAAGGAAGCCGCCG
CACAAAAGACTTACCTTCTGAAGATGCTGGAAGAATGCGTCAAGACATATTTTATCACAGCATCCTGTGTCCAAACTCTTTTCAGTGCGCTACGATATGA
TCGTCGAAATGATGCTTTGTGTATCAAAATCCTGGAAACGTTACGTTTGCTTGTCAGTTCGTTTGGATTTGCGCTGATCTTGGATGCATTGACTCGTAAT
GGCGGACGTTCTATCGAGTTGGTGATATCGCACTTTGACCACCAGGAACCTTCTGTCGTGTTATCGACAGTATCGATGTTTTATGAGCTGACCAATCATC
CTGACGCTAGAAAAGGACTGACGACGGCTGGCGCGATTCAATTGTTCATTCGATGGTGTGATACAGACATTGAAACTACCAAGTCTCCTCTACTCCACGT
CTTGGGCTTGATAGGTATGGCTCTGCTTGCTCGGCAAACAAACCAAGCCACGTCGTCAGCACGACTGCTATCCTCGTTGGCGACGCTACCTGATCGGTTG
GATGTTGCTTATGATCTCCTGCTTGACTTAGTTTGGGATGACAACAAGAACTTTCGACTTGCGGAAAAGGCAGCAATGTACTTACTCTCAGTCCGTGCGC
TTCCTACACTACTGCAGTTTTTCATTCGAGTGAAGCCCAGCTGTATGGACTCGCCATTCCAGAGTGTAAGACAACGCAACATCAGCTGCATCGTTCTCAG
TCGTTTCCTCAAAGTCGCCGAGGTTGCACAAGCCTGTTTCTCAGAAGCCCTCGTGAATCACTTGGCACTATCGCTGCAATGCAATCGCTTGGATGAGATT
GAGCACTTGGCGGCCAGAATGCCCGCACAAAACCGATACATTCACAGGTTAGGCTCAAAAGAAGCTTGCAAAGCTCTGAGTCGTCTCGCCCGATGTCCAA
GTACGAGTGTGGACGCCAAGTTAACACCATCCATCACCTCGGCAACAGTTCCGGAGCTACCCCAGGCACTTATTTGCGATGTGATGTTTCGCCTCCATGC
GCTAGAAGACCTTATTGCTCATATCAAATGCCCAAGCGATGGGGCTGAATTTGTTGACCTTGAATTGGACTCCATCATGGCTGCGATTGAACTTGCAGGG
TACTTGCGACCATTGCCATTTGGGGAAGCGGCCCGGGACAAATTCCTGAAAGCATTTGAATCACACGCCTATGGGAAATACGCGCGAGAAAAGCTGATCT
CGCTCATTGAGCTTGTAGCGCCTACAATGCTTCATGTGCTACGCGAGAAGAACTTACGCCCTCACCTTGTGAACACGTGCTGTACGGCATTGAGTCGGTT
AGCATGCACCAACGCTGCATGCAGTCTACTCCTTTCTCAAGGCTGCCTCCATATAGCGATCTTACATGTGCCGGAGGTCTTACTCGTCTCGCCAGATCCA
GGCACCAAGTATCAAAGCTTCGAGTATGATTCGTCAGTAGATGACCATGGTCTTCTCGATATCCCATCCTCGTTGTTCACACTCGTTGGCAAGCTTTGTG
CAGTTGCGGAAGGGAGAACTGCGGTAATGAGGGCTCAAGTTTTGCCACGAATTCTAAAAAGACTTCAACTCCGAAACCTAGCGTCACAATCTGTCGATGA
AGAATGCAAGAGCGAGATTGCCGTGGTGATCCATCAGCTCGCTATACTGAACACGGTTGAAGGAAACACGAGTGAGCTCTTCCTTCACTTTCACGTGCTT
GAACTGCTGATGCAGCTGGTACGCGACCAAGACATCCCAATGCTTTTTCAAGGGAAAGGAAAATCTCAGAAGTGGCGCTTACTGGACCATGTACTGGGTG
GGATTGCCGCATTAAGCCAAGACGTTCTAGTGTGTGTGCCCAAGGTAGCTGAAATGGGGGTGCTGCAATTGATCATGCCATTCATATTACGGAATCGAAA
GGACGAAGCTGCTGCCCGACTAGAGTCATTACAATACCATGCGGTCAGCATCGTGCGCTCCGTGGCGTCGTATCCATTCGGGAAGTATCATAAACTGCTG
CAAAGCATTGAAGAGAAGCATTCATTTGCATCCAGTAAAGGAATCCCTGCTGCACTGCTGGAGAGAGTGAAGAAAGTTGCTTACAATTTCGCGCTTGAAC
TGGAAAATCGACCGGCATCGTCGATGGACAAGAAAACTGTTGGCGAATTGGCTCGAGAAACGCTTTCGTTCATGCATGACCTTGCACAGCAGCAAAATGC
AAGTTTGCAGCAAAGTCAGGAACTAGTTCCAGGAACTCGGTCCTCCTTGAGCCTGTCTCCGCTGAAAATCAGGCACAAACAAGACAGAGAAGCACTCTCT
CCGCCGCCACAGCGAAGGGAATCTCGACGAAGTACTCCTACCAGAATGGGTTCGCCTAGTATAATCACTGGTGATGCTGGGAAAGCATCACCATCATCAC
ACTATCAACTTGGTCCAGTGCGGTCGACGCCATGCTTGCTCATGCATCCTCCGGAAAGCAGCAGTCCATCGCCTCGGAAGTCTGCGCCACAAATCCTTGT
AGCTCCATCCGGGACGGCTCCATTGGGCAAAAACAATAATCTGGATGGGGTGGACTTGCTGGCAACGAGACCAACCCAAGGCAAACCAGAAGGTCCGAAC
CAATCGAAAAAGAATGTCGGGTCAATGCTGCAGAACGCGTCAGATGAACAGCACTCAGCCCCACCATACATCTTTGCAAGACAAAAGCCAACTGCTAAGA
AGATCAGCAAGAAGAACGACATGACAAGCTGCTTGATGCTCGATCCGCTTTTTCAAACAAGCTCAAGTGTTGCTACGCGATCTTCATTACTAGCGGACCA
AGACAGCCCCGGTCGAAAAAAGCAGAGTGCAAGACGGAAAATCAACGACAGCAGAGATCAGCAGCAAGTGGCGTGCACTGAAGAAACGAAGGGTGAAGAC
CTGTTTGTGTATTCCCAAGAGATCGACAGATTCGACCATTGCGTTAATGTGAAAGCGCGGCGAGCCAAGGCAGGNNNNNNNNNNNNNNNNNNNNNNNCAC
GTACACTCGGTCGCTTGGACACATTCACATGACGGGCGCCCAGCAGATTATTTTAGAGTGAGTGGACGTGATCACGTGGGAAGAACAATGCAAGTCTTAA
GGTCTATTCATTAACAAAATGCTGAGGCAAAAACATGATGGCACGGCGGTGTGCGCACTTGAAGAAGAGAATCGAGCGAGTCTTCAAGTCGTGCCATCAT
ACCAACTCAGCAACTCTATCTAAACCAGATCATGCGAGCGCTTCTCTTCGTCAGAGCGGCGCATGCCGTTTGTGCCGTATTTAAGCTTGCCAGCCGAGCC
ACGACGCAGCAGACGCTGGGAGGAGCCCGCGAGGGGATTTGGACTCTGACGGTACAGCAGCTTCCCGTTCTTCTTTTTCATCAAGTGCGTCTTCTGGAGA
CTTGGCGACGTGTACATCGGAGACTTTTCGAAGGACTCCGCGCCGCTCTTGCGCTCTTCCTTCTCAGAGTGGTACACCAGCAGACCCATGACCAACACAA
ACAGCGCGAAGCCATCGTAGATCGTAAACTTCTGGCCAGCAGCCGCGCCCGTGAGCGCTGGAATCATATACAGCAAATCCGTCAACGGGAGACCAACGGC
CGACGACACCACAAAGAGCACGCTGCTACCTTCCTTGAAGATGTACAACATCAACTGGTTGTACATCATGTTGAAGATGATAAATACCATAAACGTTTGC
AACACGCCCGAGTCGCAAGGAACGATTTCGCCATTGAATTCCACCGCTTCGCCCATGAAACAGCTGTGCGCTTTACCAATGTACGGCAAGAACTCACTCC
ATGGAACAGGCGGATCGCTGAAAGCCTTGATGCGGACGGTCCAAATTGAAGCGATACCGAAGAAGAGCTGGTAGAAGCTCACCCATGCGTTCGCGTACCA
AATGTCGAGATCCGTGTCCTTCAGTCCCATTTCTTTGTACACATTCGACGCCGCAGCCGGAATCAAAGACACAATGTACAACGAGATCCAGCCAACGGTT
GGGTCCGGCATGTTCGCCGAGTCTTGGCCACTGAGTACTGGAATCATGTTGACCAGTCCACCGTACAGCACCAGGATGGAGCCGAGAATGTGGCCACGCT
TGAAGCGCGTTTGCAAAAAGATGTACGCCAAAATCATGTTAAACGGCAAGTTGAGTTGACTCAGCACGTTTGCAAGGTTTCCACTGCAGAGAGGCAATAG
AAAATAACATGGCGTGAGTTTATAATCGCTGCAGCGCAATTGGAGTGCAATTGGACCTACCCAATGTGCGGCGTCGGAAATGCACCAAGCAAGTTGTACA
GCGTATCGAGTAGCGCCATAATAGCGTATTTGTAGTGTGGAAATTTACGCATCTCGTCCGTGATGTCATCTACAACATTTTTAAATCGACTGCGTTAGTC
AATACGCACAACGGATTCACAGCAGCAGTAGCAGCACAACGTACCGGTGAAGAACATCTTGTACCTGAACAAGATCGACATTTGACAACGAGCACAGCAA
GAATGAGTACAAGAAGTGGGGGTCACGTGAAGCAGCACGCATGGATGAGGCTTACCATACAACCGGCCATGACGTCACGATAAACGCGATTGGGAGGATG
ACATTCGAGAAATACCACAGGAAAATCGTGTAATCATACGTGATACGTCTGCAACAAAGATGAAAAGAGCCAAACACATCAGTCGCCCTGCACGATTGCA
CAAGAGCGCATTGAAGTTAAGGCGAAAAGCAGTACGTACGTGTACAGCACCCGATCAACGCATCGCGCCGCGATGAGGAGCACCAGTGCGATCGCAAGCT
TGGACTCCCACAGCAGCCGTTTGACGTTCAT