Description :
From Genome Similarity Track
Location :
contig_47:319350- 322293
Transcript NameFunction/comments
g9699.t1RAW31263.1 Glutarate-semialdehyde dehydrogenase [Phytophthora cactorum

Sequence
2943 bases(100 bases per row)
ACAAGCTTGAATTCGTGCAATGGGCCACCAGTTTCTTCGGCTACGAGCCGTTGCCGAATGCCGCAGAGCTGTGCCGTCAGCGCGACCTCCGTTTGTTGCA
GCTTCGGAGTGCCATCAAAATCCAGTCGGCGATACGTGGATGCCTTGCACGTGGTGGACTTTGGCAAGCGAAACTCAAATTTGTGGAGCGAAAAATTCTA
CCCAAGATCCAAGCGCGTGTGCGAGGGTTCTTGCTAAGGAAGAGCTTGGCAGCGGAAAAGCAGTATCAACTAGAGGAGCATGCTGCTCGCTCAATTGGGC
GTGCATATCGCGACTTGCAGCTTCGACGCATGTTGGTGCGTGCGAAGCGCTTGCGGCAAATCAAGGAGCATGAAGATGAGGCTGCTCTCATTTTCCAGAA
GATTTTCCGAGGGTATCGTGACCGAAAACTTTTGGCCAAGATGAGGTATGATATCTACTGCGAGCAGCAACTCCAAGCTCGTGTTCTGGTGATGCGAAAT
TTGGCAGCCACAAAGTTGCAACGTGCGTACCGAGGACATCGCGGGCGGTCCGATGTTGCCATGTTGCGCTCAATCAAGGAAGCAAAGCGTCTTCAGCACG
AGAAAGAAATTCGCTCAGCATCTTTTATCCAACGTGTATATCGAGGCCACAAAGGACGCACGGTTCGTGCTCAGCGCCTTGCAGAATTACTTCATCAGCA
ACAATGCGACCAAGGAGCCATCAAAATGCAAAAGGTGTTCCGTGGCCATCGAGCACGACGGAATGCAGTACTGTTGCGTACTGAAGCGAGTGAGTTACGG
ATACTTAACGCCGCCTTGACTATTCAAAGATACTGGCGAGGAATCCGCGATAAGCATTTGGCCGCGGTGTTGATTGGGTTAGTCAAGCTGCGTGCCAGGG
AAAACGAGGCTGCCTACTCGATCCAAGCTGCTTATCGTATACATGCCTCCCGAGGATTCATGAAGGCGATGAAGCTGGCTTTGGCAGCGCAGCTGAGAAG
AGTGAAAGCAGCTACCGATATTCAACGTCTCACACGTGGACATCGTGGACGGGCAGAGGCTGAGCTTCGGAGGGAGTTGCAACGATTCCGTCACCAAGCT
AAACCGTTATTCGCGAAAGAAGCACGTTTACAAGCACTTGTGCATGACCTGAACGAGAAAGTGGAACAGCTACAACGTAAACTCACTGCTGATGAAGAAG
AAGAGCGTGCTCTCACGCTTGAACTCGAGAAAACGCTACAGATCAGAACAAAGTACCATGACTCGAGTCGTATCACGGGCACACCCCAACGCTATCTGAC
GCAGTATCTGCAAGTACAGCTTGCCGATCAGCTACGGGCAAAGCGAACTGAGATCGCCCTTGATGAACGGGCTTTTGAAACCTTAACGACAAATCTGAAT
GACGCTCAAAAGCAATTGCGGGGCGTTAGGCGGGAGCTGGAGCCGCTAACGGAAGGTGTTATCAAGAAAACACGTGAAAACCGCGTGAAGAGGTTGCAGG
ATAAAGTTCGCCATGAACGTCGAGCGGCAACTACTATCCAAAAGGTCTTTCGTGGCTTTCGCGTGAGGTCAGCGGTTCGAGAAGGTGGAAATTGCTGGAC
GCAAATGGTTTCACCTGACAATGCGCGACCATATTTCTATAATGCACTGACAGGAGCGACAAGGTGGCATCGTCCTTTAGCAATGGACATCTTCGGAGGC
CAACTTGCAGAGCCCCAAAGCGTGCATAAACCGCTGGGTGACTCTACTGATACCATGAATTCGCGTCGTTCCACCGGCAGTATTGGGACTACTCGATCAC
TCCAGTGGCAGTATCGATATGGTTACGAATACGACGCTGACGGTAAGCTTGTCAAGAGCTCCAGGTCACAACCGCGGCCTATATGGACCGAACACACTGA
CCCTGACTGCGGCATGGCCTATTACTACAACGTGCTCACCAATGAGTATCGATGGGAGAAACCTGCAGACTTCGACATCAACTATGAAGCTTTTGCTAGC
GGACGTAGTGCAAGCAGCTCCGCTCGTAAGTGGTTCGAGATGGCCCATCAAAAGCAAAATGCCGACGGCAGCAGCTCTCTCAGTTCTCGATCGTCGAAGA
CGCGCGCTTTCGGAAAGAAGTGGGTGGAGCTGGTCGATCCAGAGACGCAAAACACGTACTACTACAACGAGGTGACAGGAGAGACGCGGTGGTCCCTCTC
TCCTCGCAGTGCATTGGACACTTCAGATACGGAAGATCAGATCTCCTTGGCCCTGCTCGCGCAGGTGAAGCAACTTCGCGAGACGCCAGTGCCGTATTCA
TCTCGGGACCAGCATATGAGCTGGCTGGAAGCAGCTATCGCCGAGAAGGGCTGGAAAAAAGCAGACGCGATCGTCCAGCAAATCTTCATTCGTGAACAGA
GCCAAGCTGTAACTGACCGTCGAGCTAGAATCGCAGCCGAGGAAGCGGCGAGAGCACCTGTCACCTCAGATACAGCGAGCAATTTCTTGACAAGCAGCAA
TGTTTCCTCTGTTTCGACTCCGAGCGCTTGGATCGAATGCACTGACGAAAGCAGTGGCGCTACGTACTTTTACAACCAGGTGACCGGAGAGACAACGTGG
ACCAAACCATCAACAGCACCTGCAGGTCAGTGGGAAGTGGTGCAGGATAACGATGACAAGGCGTATTACTACAACCCTGTCACAGGCGAGACGGTATGGT
CAGAGCCCACCCGGTGAGTTCGAAGGAACATATAACTTTATTCCACAGTACACGTCTGGGTCAAAACAATCTGGCAATGGAAACTTATGCCTCCAGGCCG
CCCATGCAGACCATCTTCGTCTCCTGATACTCGTCCAAGCCCATGAACGAACCTTCACGACCGAGGCCAGACTGCTTCACGCCGCCAAACGGAGCCTGCA
CGTTCGAAATCACGCCCGTGTTCACACCGATCATACCGCAGTC