Description :
From Genome Similarity Track
Location :
Scaffold_1230:3193- 4361
Transcript NameFunction/comments
Phypl_g12826hypothetical protein

Sequence
1168 bases(100 bases per row)
AAAGAGAACATGGTTCGCGGGTTACTCTACACCTGTACGGGTTACTCGACACCTAGATTGTGGGTACGTGTACGGGTTACTCGGCAATGACTTTTATTCG
ATCTGCGTCTCATTTCCTATTAACTGCGATTCTGAGCACCCGACATCGGAGATCAGGTACGATGCCTGGGGTACTATCGTTGGGCGTACAGGAGCCTACC
TCAGTGGTTAACTATTTCTAAGACGTATTGGGTGTATCCAGGAGTAGGATCTTGGATGACGCCAGTTTGTAATagatgctggtggcgatggatCATGGTG
TTGAGGGAACCGGCATTATGAAGTGCATGCAGATGCTTCAGAACAGCGCTGGACCCGGGAGAATTCAATTTGTGATCATTTGCGAGAAGAATCAGCACAG
CCTTCTCGGCGCGCTTTCCTACGGCAAGAACTTGGTCGCGATAGTCGGGCGCCTTCTGGTCGAGTGCGAAGCCATCAGCAAGGAATAGTTTCATGAAGGC
CACGATATGCTTTGATGGGGAACGCTACCGCTTCGGCATCTGCTTCTGCCAGAGTGGTTCCTGTGCGTACCACGCAAACCAAGTTGCGTGAAGGTAAGTC
ACTGACCCTCGTCTGCGTTTTGGCTTGTCTTGTTCTTCACTTGGATCTCGCTGactcttcttgcgcttcggTGGTGCTGTGCTTCCTTCCAGCTTAGCTT
CCAGGTCATCCATGCGCTCGTCTTGACGCTTGATGTGCACCATTAATTGGTCAATCACACTGCGTTGATGCTCGACGATCTTGTTCTCGTTGCTTGGTTC
CTTGGACGGTGGTGATGTTTGGTCTATAGGTGGCTTCACGTTTGTAAGTCCACAGGCAGCAAGTTGCGAAGACCGCGATGATCCAGCACTAGCAACAGCA
AATTCGAAGCGTCGAACGGCAAGACTAGCGATttggagcttcttcatcctAGGGTAGTACAAGACAATGTAAGCTGTGTGGACATCGGTGACTTGCTGGC
TGAGGTTGTACTTGGAGCTTTCCATTTTGTAGCAGGTCGTGAATAGCTCGCGTTGGACAGCTACGATCTTCTCCTGTGTTTCAGCGTCGAACAGCTTCAC
GTCTAGCGCCTTAACCGCAGCCATTGTATCGTATCCGCTGAGTGCCTTGCTAACCTTGGGGTCTTCTC