Description :
From Genome Similarity Track
Location :
Scaffold_21:31925- 57448
Transcript NameFunction/comments
Phypl_g902hypothetical protein
Phypl_g903cytosol aminopeptidase, putative
Phypl_g904hypothetical protein PHYSODRAFT_532549
Phypl_g905hypothetical protein
Phypl_g90660S ribosomal protein L13, putative
Phypl_g907folate-Biopterin Transporter (FBT) family
Phypl_g908hypothetical protein PHYSODRAFT_566444
Phypl_g909conserved hypothetical protein
Phypl_g910conserved hypothetical protein

Sequence
25523 bases(100 bases per row)
AATTTGTCAATTCTTCGAGTTTGCCTTGCGAGATCCTTTCTGGAAGAAAAGCGGTGGTGGGAGTTCTCTTGGAAACAGCAGGTCACCCTCGGACACAGCA
TTTCGATCGGCTTGGTGGGATTTgagacgctgtcgctgggtAGTGCGCCGCCGACTCGATGCACCCTTCCGCTCCCCGCAGCTCTTGTAGTAGGTCACGT
ATTCCTCGACAGTAGAGCCCGTGGCCTTCTCCGTTCCGCTCTCCCTGTCTTGGTGAATCCCAGCCTCCCAATTCCTGCTATCTAGCGCCGACTCGGCTCC
ATCTTCGACGAGCATGTCTTCGTCACATTGCACGCTCGAGTCCTGCATCTCCGTCTGCTTGCCCTCATGCACCGCAGTCGTTACATCCGCTGTTGGTTGC
TTGTCCTTTGGTTTCTCGTCTTCAGCTGTGTGTTCCGGAATTGCCGACTGTACGTTCGTCTCCTTCTCAGCCACTTGCACACGTGGACTCGACGGCTGTG
ACTTGATTACTCGCACACCCAGCGCGTGCGTTAGATGCGGGGCCAGAGACTTGCCCAGACATGACAGCGTGACAGCTCCTGTCACGCTGCCCACGAGTGT
GTTGTGATGGTCTCGGAGCTCCCACGAGCCGCTGTGACTCGCCCACTCGCAGATGCGGAGCAACCTGCTGCTAGACAGCACGTCACCGTCCAGCAGCCCA
ACGTGGAGCAGTAGCGATACGGTCGCAAACGCTCGGAGTCGTGCCCTGCCGTGCTCCTTGGCGAGCAGTAGCAGCGTCAGCGGTGTCTCCGCGTCTCGTT
GCAGGtcgcgcaccagctcgtccgggTCTGCTTCGAAAAGACAGGACTTGCCGTGGTGCACTCTCgtcactgcagctgcagaggCCTCGGCGAGGGCCAA
CGCGGTGTCGAACACGACGATCTcgtactgcagcaactggaagGCCAAGTGGAGCACGCTAGagggcgatgacgacgctggcACGGGGTCTAGCGCCACG
CGGTCGACGTAGAATTGAAGCGAGAAGAGCAGAGAAGCAGGTTGATGAAGAGTAGATGCATTGGGGCCGCTATCAACGCCGCACGACGCCACAGAGACCA
AGTGCGCATTGCCTTCCGCGCTATCGTCGGCCATGGTGTAGGTTCAAGTCGCCTGACCATCACTCTAGGTGACCCCTTTGGTAACCGATGATCGCTTTGT
AGAGGTGCATCTTCATCCATCATCACTGCCCCACATTCCTGCATCGGAGACCGAGTGCGCATCATCAGCATGCTGCGtcgcttcttcagctcctcggccg
cgcaccgcatggtgcagcagcgggtgcaAGGCcagctgtcgctgctgtccaaggcCTCGTCATCGCCCTCGACGCGCGTGGTGTTCGTGTCccgctcggc
cgccgcctcaGACCTGCAGAGCTCGTTGCCCTTCCCCgtgtccgccgccgcgctgcgcGACTTCAAGGCCAAGCCACAGGAGAAGCTGTACCTGTACCcg
agcgtggacgacgaggcgctcaaggaccagcgggtgctgctcgtggggCTCGGAGACGCTGACAAGGTGACGCccaacgtgctgcgcgacgccacgcacg
gcgcgctgagcgcgctcaaggccaagcgcgccaaggacgtcgtggtgcaAGTGCCCAACCTCGACGGCTGCAAGCTAGACGCCACGCGggtggtggagct
gttgTCCCAGGCCTCCATGCTGTCCAACTACCAGTTCGACCAGTACCTGACGGACTCCAAGGACGCCTACGGAGACAGCAAGCTGCGTCTGCCCCTCGAG
GAGATCTACCTGGACGCCTCGACTGAGTTCCAGAAGGTGAGAGAGTGGTGCGGGATTGGAAGTGAGACTTGAGGCTCACGGGTGTTTTGTGGTGTGGTGC
TGTAGAAtgtggcggagcaggcgaCGGTGGGTGAGGAGACGATTTTTGCGCGCAACCTCGGTGGGTAGATGGAGTAGCGTCGTCAGAGAAATTATTTCTG
CGTGCTGACTGTGAGATTTGTTGTCGAACAGGCAATGGACGCTCGCACATTGTGAATCCGGCGTtcatggaggaggtggcgcgcgcgtcgGCTGATCTTC
CCAACATGTCTgcccgcgtgctgcagcagaaggacctggagaaggAAGGCATGAACATGTTCCTGAGCGTGGGTCAGGCTGGTGTATGCCCTCCTCGTCT
CGTTATCCTTGAGTACCGTGGAAactccgactcggacgagaagGTCGCGCTGGTCGGCAAGGGGATCACGTTCGACACGGGCGGTTTGAACCTCAAACCG
ACTGGTTCTATCGAAGACATGCACACCGACATGTGTGGCTCCGCTGCTGTGCTTGGAGCTGTCCGTGCCGCTTCGCGTCAGGGTCTCAAGGTGAACATCG
TCTGCGCACTTGCTCTGGCTGAGAATGCGATCGGATCTAAGGCCGTGAAGCCGCTGACGATTGTCAAGTCGCACAAGGGCATCACAGTGGAGAACAACAA
TACAGATGCTGAGGGCCGCCTGGTGCTTGGCGACGCGATGTCGTACGTCCAGAAGGAGTACAAGCCTAAGAAGGTCATCGATGTGGCTACTCTGACTGGT
GCGTGCATGGTCGCTCTGGGTGAACACTGCGCTGGCTTGTTTTCCAATTCGGATGtcctggccaagaagctgcaggagacgGGAACAGAGTGCCAtgagc
gctgctggcgcctGCCGATTCTCCCAGAGAGCACTGCCGCCCTCAAGGGTTCGCAGTCGGACTCCCGCAGCACAGGTCGCGGTCGCTATGGTGgcgcctc
caccgccgcagctttcctgcagcagttcgtctACGAAGGTGTTGAATGGGCGCACCTCGACATTGCTGGACCTTCGAACTACAGCTCTCCCAAGTCGTAT
TTCCCCAAGGGTGCAACAGGCTTTGGCGTTCAGCTACTCTACACCTATCTGAAGGAGCACGAGCATCACTAGAGAGCAATTGCCCTTTGATGGGGCATTG
GGAGCACATACGTATCGAGCCCCGTGAATATATCTGcgttgtgtttgttgttaCTCAACAGATATGGCAAATATGAAGGGCGTATTGAAGCTATGGAATC
GGGTAAGGATGGTTACTGCTCTGTGTACAGGTTCCAGACGAAAACGCAGCCATCGTCACCGACTGAGACGAGTTGTCGATCATCCGGGCTGAACGCCAGA
CCACGGACATTGCCGGAGTGCCCCAGGCCGTCCTTGATGAGCTGGTTTGTGTTGAAGTCCCAGAGTTTTACGAGGTTGTCGTTCCCACCAGTGGCAAACA
CTTCCAGATTATGCGCCACAGCGATGCACGtggcttcttcgtcatggGCCTTCTGGATCACAGTTACTGGCGTGTCAATGCGCAGGTCCCAGTACGATAT
GTGCTTTTCTTGGCCAGCGCTTAGAACAAGACGCTGGTCTGCAGACAGTGCCACGGTGTTAATTCCGCCCATGCGTTGGATGTGACTTGAAATCCTGCGT
TCACTGCGTAGATCCCAGCAGAGCAGACTACGATCTCGACTGCAAGAAATCACATGCAGGTCGTCGCGATACAGCGCCAGGCTCGAGACTGCCATTGAGT
GCTCCTTGAGGTGCGAAACCAAGTCACGCTTGCGAATATCCCACACGCGCAATTCGCCACCGACTCCCGCCGACACTATGAAGCGCTGATTGTGACTCAG
AACCAGTGTTGTGATCCCACCGGTGTGAGCATTGTCGATAGACCAAGCCAACTCACCCGAATCACTGCTATGAGATCGAATGCATCCGTCAGTCCAGCCT
GAAatgagcacgtccagcgaaTACTGGAGAGATGTCGGTGTTCCGGCATCGCCGACGAAGCAGCGGGTTGCAACGGTGTAGTCTGAGGCATCCCACACGC
GAATAGTGCAGTCTCGAGAGATGGTGGCGAAGCGATCGGATACCTCCGCCGCGTACGCAATCTGCACGACACCATTCGAATGGTTTTCGGACAGCAATCT
CGCCTGCAGACTGCGTTGCGAGGTGCCAAATGCAAGACGCACTGAAAAAATACTCCCAGCTTGCGTGCCAGCGACGATCTCATTTTGAGCTGCGTTGAGG
CTCAAGCCAATGACACCGCTATCAAGTGCGACGTGGCAAGTATCAACGAAGTCGTGTCCATAGTGCAGAATACtgccatcaccaccacccacgaggacgc
cgccgtcgaaaTACAACATGGAGTTCACACCACAGGAACAAGCTGGAATGACCTTGCAGAGCTGTCGAGTCTTGACGTTGACAACGCAAAAGTCACCGCT
AGAACTGCCAGCCACGAGAACCTCCCGGTCCGGGGAGAACTGCACGCAGGTGTAATCACGAATGAGTGCCTGCTCGATCTTGTGCTGCGTGAGCTCTCCG
GTGACTGGATTAAGAGCCCAAAGCAGTAGCAATCGATGCCCGACCGTTGCAAATTGGTAGCTGGTCGTGTCGCGGCGCTTTACGTCACGTGCCATACCTC
CGAATGCAACCGCGGTGACGATGTTTGACATCTTTTGGTGTGTAGCGCAGATGTTGCCCGTAAGGACGTCCCAAATGTACAGCCGTGGCCCGTCCTCCGG
TACGCCCACTGAGCACAGAAgtcgctcgtcgtccgagaaTGCAAGTGCAGCGATTCCTCCGTCGTGCTCCGACAGCCTGAAAGCGAGCCTCCGAGCTGAA
TAATCCCAAACGAGGACGTCTGCTCGCCTGCCGCGCTCACCCGAAGCTAGAATTCTTCCCGACGAGGACATCGCGATGCATGATACGTTACCCGCGTGGC
CCCGGAGGAAAAGCTGACTGTGCGCGTCTTGAAACGATGTCAGCAACACGGATCCACCTGCAGGATACACGTAGTCTCGGCCCGATGGGTGGTAATGAAT
GGCATTCGGTACGGCTGAGAAGCCGATAGTGTGCTCCAGTTCAATCATGGTGGCGCACTGCGACTGCTGATCTGGCCGTAGGTGCGGTTCACTTAAGGTT
GCGGCGTATCCCCTTGAATTGGGCTTGCCATCCATGACAGGAATATCTTCATAACCACGAGCGTTGTTGCCACCGCCATACTGCATTGTGTCGAGATACT
TACAGGATCacgagcgccttcttgatgcAATCAGCAATGTGAAGGGGCCGCAACAGCGATCAACCGAGGAAAAGTAACCACTAAAACTAAACATATATCG
AAGTTAGCAAGTTACTCCAACAGTGTCCCGGACTCGAGAAGCCCCGTGGCACCTACATAACTCAAGCACGTATAGTAGGGAGGCAAGTCATTCTCGTGCA
TCCACCGGGCCACGTCGAGGCCGATGTCTTCCTGCCGGTCGAACAAATTCAATCGCAGGACGCCTCGCGTGAGAAATACCCGGGACGGTAGCTCGAATGT
GTGCATCTACAGTAGTCAACGCGCAGGAAACACACGTAACATCATTAGTCTTGTGTGcgcagctacatgtagaatGTTGCAACTAGTAGCACAGCTGCGT
ACCTTCATATCATTGGCAATACTGAAAACCATGGACTCGTAGACCAGCATGCCGATctctccgtcgtctcgcAGCTCATACAGTGCAAACGATACCCGCT
TCGGGGAGTACGTCGGACTGCCCGGGTACCAGAACACTCTGTAAGGCACAACCTGCACGCTGTTGACCAGGGAGTTCTCCCACAACGTGTAGTCCAGATG
GTCTGTCGTCGAATACCCCCACGTCGAGGCGCTACACGTCCACCACAACAGCCCCAGTCAGCACCTCACAAAGGGCCTCCCTACACTGCCCCCGACTGCA
ATACCTGCTCCAGTAGCACGGCCGTCCCCTTGCACAGCCGCattccagctgcagcctcttgGCGATCACCTCGAAGGCCATCGGGTCGTCGGCCACTACC
GTGCCGGACAGCAAGGCCACCCCAATGCCGCAGTGCGACCTCGTCAGCGTGTTCTCCGCCGACTCGTTCGTGTGATCCACCGACGAACactctgcagcag
ttgcagcagcaagagcaagagcatTTAGCACAGTCGTTAGCGTCAGCGTCTacgcgccaagcagcagccccaaaCTTGACGCTCCGGCGTCACCTCGCAC
TTGACGCAGCACCGAGAGCTCGTCGCCCACGGGACtctgggccagcagcgccaggcgcTTCCAGTCGGCGGAGCTGCGGGCGCGGCAGCCGCTCGCATAC
AGCGCCAGGCGCTGCGCCAGGACCCGCCACGTGGCTGAGGACAGAGCAGAGCAGAGGAATcagatgacgctgctgtcgtatCAGAAGGAGGAAGGAGGGA
CGCACCGCAGTGGAAGATGGTGTCACGCACGCGGCGGTTGACGgcctcgaggcgcagcagacTCGTGTAGTCCGCGAACTGCAgcatcgccgccagcagg
tcgcTCGGCAAGTCGCTCAGCCCCATCCCGGTCGCTACTGTAGCTTCTGGGCGACAAAGTTGAACCTGCACATACAGTACAACAAGCCATATCTCGTAAC
GTCTTACCATCTACACTAAAGACACCTTAGGACATCTGGTTCCCATTGCTGGAAAGTACGTGGCATTTTACGGTCTCCGATCAATGTGTCAACAGAGATG
ATGATGTCAATGCACAAAACCTATCGGCGTGTTATTCCCTAAGTTCTGCCTGCGATGAGGCTGGGGAGTTATTCTGCAGTCTAGTCGTCCCAGCGGTTCA
GAGCCTGGCGGAGCATGCGCTGGAACTGGGACGTGGCAgcgcgctccttctcgatctcgacTCGGAGGCGCTTCATCTCGCCCACCGCCTTGTACGACTG
CGCCGACTCGTCGACTGATCCCAGCGCTTTGGACCCAAAGCTCCGCCGTACGCTCTGCACTGAGACTTGCAGCTGTTGCTTCACTGCTGCGCAGTCGCGC
TTGGTGCTCTGACTGGAAACTGGCTGCGTCGACTTGTGCACAGCATCCAGCAgactcgagacgctcgatCCGAAGGCGCGCCAGTCCGCCGGGTAGAAGA
TGGTGAGGTCGCTCAGCGTCTCGAAGAACGTCTCGTAGATCTCCTCGAAGATCCTCCGCCATGGCAGCAACGCGTCCGCCTCTTGTGGGGCCACCTGCTC
AGTCTTGCCGTCTTGTGTCAGTGCCTCGTGGATGGGAAGAAGCGTGCAATAAAtccgcttcttgagctcgtacgTCGACAccgctgtggctgctggatAC
GACAGGAACAGTCGGTCGATgaactcctccaccttcttgaagTAGACGTCGCAGGTCTGGTCGCGGTTCACCGGGGAAgtctcgacgacgaggcgaGTGA
CTTCAAGCGCCGTCAGAATCGTCCAAATCTCGTGCTGTCGCTCCTGGGAGTTCCATCCAGGCGGAGGGTCCACAACAGCAAACTGCAGCTCTGGCGGCGG
GTACGCGAGGTCCATGACGCCGGACGACAAAATATCTTGACGTACACGTGGGAAAACAGCGCAAATGCTGCTCTGGATGCCAAGTGACGACTCGAACTGG
TTCAGCATAGCCTTGACACTGCCCTCTAGGAGCTCCTTCAGTCCGACGCTCTTGAGGCGACGTACAGGAGGAGATAACGCTGCAATTTTCCTCAGCACTT
GACCGAACTTctgaggaagaagatcacCCGGGTCAAcaagctcgacgccgacgtggaccACCTGCGCAGCAAATCGGCTTTGCACGCGTTCGATACAGCC
CCCGAGTGTACTCATGAGCAGCGCTCGTGAAGGCTTGACTTCCACCGAAGCGAACCCGAGTGCAAGCAGAGTCACACGGCACCCTCTGCTGAGCAACGAT
AGCAGCTCGCCAACTTGTTGCTCCCAGGCACTGCGATTAtcagcttgctgcagtgtACTTAGATCAACAGGTAGTAGGATTGCCGACGTTGCGGCGAGCT
TGCTTTGCTGTGCCTCGTGTGTGTTCCGCTGAGCGAATGTCGAATCAAGATACCGACTGCACACAGCAACACCTTGTGTCACTCCATTGATCGACTGATA
GGTGCGTTGGCAATCGTGCTCAGGTGTAGAGACATCCTGTGCTCCTGCCCTGACCGCACACCACAAACCAAATGAAGAAGAGGCTCCATCGAGAAGATCT
GCTATCACCAATTTCCACGCAATTGACGGTGCCCCGGGGTTTTGCCGGCGAAGAGATTCACAGACCACCCCGAGGATGTCTTCGGAGCTCCACAGCGACA
TGAGCTCTGCATCTGAAGAAGGCACGCTTTCTTCAGCCATTAGAAATTGCTTCAATCGCTTCGAACCAATCGGTGTACCAGATGCGCCATTGACTCCTCC
AAAGAGCCACTGCATACTGTCTTTTGCCTTTTGATGAGGCCGATCTAGTCGAAGCTTCGACGCAATGGAAACTGGTCCAGAACCATTGCGCGACACTTGT
ACATACTTTTTCCACATGTGTACTCTCAGTTTCAGAACGGCGAGTCGTTGCTTTTCAATGCGGCGCACCCTCTTCCTTTCTGCTCGCTCCTTGGCCAATA
GTGCTTGTCGTTGCGCTTCAAgtgcagcttcacgcgcttGGCGCGCTCGCGCCTCTGCTAACTCTTGCTGACGACGTCTCTCAAGCTCTTCAGCTGCTTT
CCGCCGcagttcttcttgtcgtttttcttcttgtcgacgtcgttcttcttcagcagctttTATCCGCATGGCTTCAGCttgctccagcgctgcaagcCTT
TGCCTCTCTGCATCGCGAGCAGCCTCTTCGGCCTTTCTGCGCTGTTCTTCcaactcgcgctgcttctttTGCTCGCGTAACTGGGCTTcgagagcttctt
gctgtcgctttgcatcagcagcttccttttcagcttgagctcggGCAATGGCTTCCTTCTTCGCCTGCTCTTCATGTTGAGAAGCCTGCTCGGCAACAGT
CTGTTTAGCCTGTTCACGGCGAGTTTTCTCCTCCTTCGCTTTCTCCAGTTCCCGCATTCGTTCTAGCATCGcccgcttcttctgctcaaGCTCCATCTTC
CTCTGCGCAATTGCATCAAGTTCGTGCCTTTGCTGATAAGTGTCTGCTGGTTGCTGTTGGGTAGAAAAGTTATTCACATGAGTTGCTTGAGCACTCGCTG
GAGGTGCCACGGGAACTCCGTCGTTGTAATCAACGAAATAAGAGTACTCGTCCTCATACGCAGGCCTGTTGGGGTACAGTCTAGCGTGTTCCTCCCGCTC
AGAGTCTTGAATCAGCTTGCTCAGAGCTGGATATTCATCTCGGGCATATTCAGTCACACCCCGGCAAACATCTCGTCGTAAATAGTTGCTGCACACATCA
AGGAAGTGGGTAAGCACCAGTTTGCCGTTGCAGCAAAACACACAACGAGTTATACGCACCCTTGCTTCATCCCGACGTAGATCTTGGAGCTGTGCGTCTT
CAACGGCGTATTGTTCCGTCGTAGCTGGCTGTCTGCACCGAATTCAGTAGTAATACACAACCGTCATTATATCGCATCATTATCAACCAGCGAGTCCAGA
GCCACTGGTACCTGTTTCAAAGTCGCCACCAAACTTCACAATAATTGAGCTGTCATCACCGGCACCAGGCCTGCCGGATATCCTCAATTGATGTTCTTGG
CATACTGAATAGGCGTGCTCAATGTCGTCAAAGCATAGCAGCTCCACCAAGTCCTCGAGTGGATAAATCTGGCTACGATATGCCCTATTCATGCGAAGCA
GAGCCGACGACCGAACGTTCGGGATATACCGGAAAAGCAAGCACGACTGCAGGTAGGTCGCTTGGCGAAGCAACAAGAAAAACTGGAAGTAGTCACCCGT
ATGGCGTGCAACAAACACGCGCATCGCAAATTTCATGTGCGCACTTTCCAATATGTGACGCGGGAAATTTTTCACATACTTCAACACGTCCATGCCCCGA
CCATTGTCCAGCGTGCAGAGAATGAAATACGCGCGACACTCAGCCTCGAATGGACTCAAGTACGCAGGATCTCCCACCTTGTGGCTTTCATCGTATAACT
CGTTCAGCGACTTGAGAGTttgtccaagctgctccatgtTTTGCTGAGCCACGAAGCTTGGGGTTTCAATGAGTTCATGCTCGCTGAGAACGTGATATCG
AGCAATACGCTCGTGAACGTCAAGCGCAATGGGGTGGACtcgaccgccagcgccgcggtAATTCTGCAGGACGAAGTCTTTGCGAATCATTCGGAACCGG
TCCCAGCAGAAGTTATACAGTGCAATCGGCTCTGGAATGCGAGGCGTCTGAAATCGGGGATCCAAACCACACTGATCCAGGTCCATGATTGCCTGCTCAA
TATACAACTGTGTGCGCCGAAGAACACCAGGGGGGCGGATCTCCTCCGGGATATCCAGTTTGTGATCAGCTGAACTACGCTGGAAACGCTTGATGATCAT
ATCGCGCTCGGATCCTGGCCGATCAGGGAAACATTTTTCGAAGACGCTCAGTTCATCCACTCGAATATGCAGCTCCCGCTCTGTCGGGCTGCACATATCA
GCGCAAACGCCATCCAGGTTTGTAGCTGCTGACAACTCAGCCTTGCTGTTCTCGTCCCGGGACGAGGTTGCGGACGGCAGGGGATCAAAAGGAGTCTCTT
CATCACTTGTGCTCGGTGCTTTTTTTTTCGGCCGAGTTTGCCGATGTTTCCCGTGCTTCTCATTTGTTGGGCTTGGCTTTGGTGCAATTGATGTCTCAAA
TGCACCCCCATCCGTAGGGAACTTCGGGCTAGTCCTAGGCATTGATTGCTGCCCACTGAAGGGATTCACATCTTGCTCCGTCGGAGCACCAATTCCTTGA
GAGCGTTTGCCCTTCTCGAACGGTGACTTTTTTGCGCCACTCAGTCGCGCCTCCATAGATGCCATCTTGCCCGAATTTGCGAATCCTCCTGCTGAAGCCT
CTGAGCCAAACTTTGGAGTAGACTGGCGTCGTGTATCGGTGGCACCACCGAATGTGGTGACCGGCCCAGCGCCGCTAGGAGGAGAGGGCTTTCCGAATGC
CGGTGAAGACTTAACCTTATTACCGCCCGATGCTCTGCCAAACGCAGTGTGAATGGTTGGTCCGCTTGAAGCCCCGCCACCGCTGGCTGCGGCACCAAAA
GGATTGTCTGCACGggcagaagacgctgcatTAGGAGTGATCTGCTTCTTTCGCACTGGAGCACCCGACGCTTGGCTGCCGAATGGTGTACTTGGCGGCG
ACAATGgtgttgacgctgctgctgaacttCCCGATCCAAATCCGTTGGAGTCTTGCGGGAAGGATCTCTGTCCGCGTCTGGGAGTTGGCGCCCCGAAGAT
AGCCTGCCCCCCTCCACCAAATCCATTGTCGTTCCCTCCGAAGTGTGCGCTGTCCCCACCGAAAGACTTCGACCCGTCACCTCCAAACGCAGTCTTCGGT
GCATTGCCACCGAATCCAGATCCCCGATTCTTCTGGTTTCCACCAGCATTCGACGCTGATCCAAACGTTGTGTGCGCACCCGCCGGCGTAGAAGACGGCG
TCGACCTAAATGTCGTAgactgcgtcttcttctggctgCCGCTCTGCTGCCCGAAAGGATTCCCACTAGTTGAAGCTCCACCAAATCCGCCCGAGGGCAT
CGGAGGTGCCCCAGCCAGGCCTCCAGGTGGGAGAGGTGGCTGCATGCTGAATCCCCCGCCTGGAGCGCCCGCCATGCCTCCcggaggcagcggcggctgg
cTGCCGAAGCCGGAGCTCTGTCCGAACGTGGTCTTCACACCGGGGCCTCTGTTACTGGCCTGGAACGGGTtcacggccgtcgtggatgCTCCTGGACAAC
GCGAAGGCACCGATCAATACCTGAAACAGACTCTACGACCGGCAGCAGAGCGCCACCGCGTCgcaagagagagagagagagagagagcagaGAGCTTGCG
TCCCGCTCGAGAGGCGCTCGTCCATTTGCACTGCCCgcaacagcacgagcacgccCCCCTTCGCACGCGTAGAAAGAAGAGTAACCGTAACCGCGTAACC
TGTCGTACCTTGGTTCTGGCCGAACGGGTTGCTGCCCTGCGCCCCGAAGCCTCCGCCTCGATCTGCGGATGACGGCAAAGACGTGTCAGCACGTGTAAct
cgacgactacgacgccTATAGAAGCGCAACAAGGGTGAATAGAGAGAGGAGAGTGCGCATAACTCACTGCCGGAGCTAAACATCGCGACAGCGTTCACAG
AGCTGCGTATGCACCGTCGAGAAGTGTCCGGAGCTGCTCTCGCCTTCGCCCGTTGAGAGCTCGGAGACTAACTGTACCCCCTCCGAGAGGTACAGTGTAC
CGGTGGTGTGGACCACCCGGGCGGACTAATTCTGCACACCCTCCTAACACGATAGGGTACGCACCGTAACCCGATCCGTAACCCGACGGTGTATGGCAGT
TAATATTAGTTCATATTAAAACCAAGTGATTAATCCGTGTCGGGTTACCTATATTATCGACTTGGAAGGGTTTTTCCCCGCGCGCTGTGATTGGCTGTGA
CGAAGGGGCATAGTGAGGCCAAGTGAGTGCGAGGACTGGAGCGCCTTGCGCGTTGGGGAACCACCAATTCTCCGCCCGGCCGGCTCCGCTTTGCTGTTGT
GGGCTCCAAGTTCCAAATTGCCCGCAACTTTCTGAGTAGCTTCGCGCGACGGTAAATGCGCCTCCTTGCATGGCTTGAGGTTGCTctggacatggaggag
acTCACGCCCGCGCCTCCTTCTCTCTGTGTGTCTTTGTAGTGAAAGATGGTGAAGCACAACAACGTCATCCCCAACGGCCACTTCCACAAGTACTGGGAG
TCCCGAATCAAGACTTGGTTCGACCAGGTACGACCCGCAGCCATTTAATACCCAGCCAGCCAGCTATACAGACCGCCAGACAGCCAGCAGCTACGCGTCA
CACACGCGTCGGAGGTCTCTCCGTCTTGCGGGAGGAGGCGTACAGGTCAATCGATCGGCGGGGAGGAACAGACAGTAGAGCACTAGGCGGTCAGAGGATC
GTTGGGACTGGAAAGACCTGCAGGACcgagtgctgctggcctACTGGCTGGCtgactgctgcagctacaGTTTCCTCTGTGAGTAAGGGGTCTGATATCA
TTGTTTTGGACTTCTACAGGCttccaagaagaaaaccCGCCGTCTGGCACGTAAGGCCAAggctgctgccatcgcccCGCGTCCGGCCGCTGGTCTGCTG
CGCCCCGCCGTCCACTGCCCCACGATCAAGTATGGCTCCAAGGTCCGTGCCGGCAAGGGCTtcacgctcgaggagctgaaggaggctGGCATCAACCGCA
AGCAGGCCATCAGCGTCGGCATCGCCGTGGACTTCCGCCGCACCAACAAGTCGGTGGAGTCGCTCCAGGCCAACGTGCACCGCCTCAAGGCCTACAAGGC
CAAGCTCGTGGTGTTCCCGCGCAAGAGCAACAAGCCCAAGaacggcgacgccgccgctgagGACGTGAAGAACGCCGTGCAGCACACCGGCCCGATCCTC
CCGATCACCCGCTCCAGCGTCAAGTCGACCACGGCCGTCATCACGCccgagatgaaggagaagagcgtGTTCACGCAGCTGCGTGTGGCTCGCGCCGACA
AGCGCATCTTCGGCAAGCAGGCCAAGCGTCTggccgacaagaaggagaagaagtaAGTGTCGTTCGCGTCGACACCTACCAGCCTGCCCTCTTGACCGAC
TAGTTATCGAGAGGAACGGCGCTCCCTAACGTCATTTGCGGAAAATTGGAACACAATACATCGCGCATCAAAAAAATTCTCGCATCATAATGGTGTGCTC
TTCTCTTCTATCTGAGCTATTGTACAAGTTAGAGCTTTAGCATGTTGGGCTGAGTGTTTCAAGATATTCTAAACCACTTTTTTGACTTGGTACTCAGCTT
CCAACTCTTTATCTTACACGCGCACGTCTGCATAGGCCTCGGCTTCCGAGAGCAATGGCTGCTTCTCTGGCTCGTCCGGTCTCATGGAGATCGACTTGAG
CTTTTCACGCCCACCCCGAACGCTCGTGTTCTCCGACGTGTCCACTTTCTCGGGCAGCACACCGAGAAACACCAAGACAAGCAACTGGCCGACAGATGCG
ATCACCACGACCAGCCAAAGACAGCTCCAATCCACAAGCTTCGTGGTTGGGTCGGGCACGAtgcccagcgccgacaccacGAAGGACGTGAGTACGCCAg
acacgacgccgccgaaGTCCATGAACGAAAGATACAACGCGTACGTCAGCCCCTGGACGTCCGGGTTCGCAGGGCAGTAGTACGTGGCCACAaccagcaa
ctgcaacaGCGCGAACTCGGACGTGAAGGACGTGATGAACGACTCGGCCGTGCCGAACGTGCACACGGAGACGGGGAGATCCACGACCGGCGGGGCCAAC
AACAGTCGCGGCAGACCAGCGACAACGGAGCACACTGTggacaggaagaagacgctccGGACATTCTTGTTGGTGCACCACTTGGCGTACGACAGACACG
AGAGGAAGCGTCCGATCATGCCGGCCAGCGACATGTACTGCAAGCactcgtgctcgtcctggAGGAGCGAGAACGTGTACTGGTACCAGATCGTTCCGTC
GCCGGGCAGCGCGTTgcacaggaagaagaagagcatgggCGGGAGCACGGGCGTCATGAGCTCCACCTTGTGCTGCACGTCTCGCTTGAACGGCAGCCAC
CACGCCTTGATCGTGTTCctccacgagcacgccgGGACCATCCCTTCCGTCCCAATGGATCCTTCTGCTTCACTGTCCGCAAGAAGTTCATCGAccggcg
tctcctccagccCAAGCAGACACActcccgctgctgcgagtggcAGCAGGCTGGTCCAGCCGATGACCTGCTGCGGCGTGATGCTCTCGTCCCGATACAC
TGggacgcccagcaccaagGCGGCAATGGACGCGGCGTTCTTCGTGCCATTGGCTAGCGActgcacgcgcgcgctgctcctgctggtgGCGTCCCCCGTC
GTGAGGTCCACGAGCAGAATGCCGAGCATGATCTGCGCGAAGgcctcggcgacggcgtccacgagcttcacgacgaaggcggcggcgacggagcgCACGT
ACGCGGcggtgagcagcagcgacgcggccgCGCAGACCTCGCAGAGGACGATGTAGGACTTGCGGCGGTACCCGAAGAGCGGGAGGCAGTCGGACAGCAG
GCCGTAGAGCGGCTTGAGGTTCCACGGGAAGAACGTGACTGAGTAGTAGagcgcggtggtggcgggcGGCATGCGGATGACGTCGAAGAGCCACTCCCCG
TAGGCCGTCATGGGGAAGgtcatgaagaaggcgtgCAGGAagtacagcgccagcagcgccagcggcatCCGCGGCGCGGGTGGCGCCATCGACTCAGTAC
AAGTCAGGCGTCTGATTCTGAACCTGTAAATCGGGACACATTACCACGTGATGCACGTCAGTGTCTCGCACGGTATTTTGCTCGAACTTGACTGGCGGCC
GCCTACAGTCTGTAGCACCAGCCACATACCATACTTGGCCACCCATCGCCTGGCGGAGGACGCTCGAGACTCTTTTGGGACATCATGGCGCGCGACGAGT
TCAAtatcgacgaggccgaggacttcgacgacggcacgcgcgccgtgctgcacgcgGATGCGgcgtcggactcggacggcgAGGCGCAGGACGCGACGCG
GCTGCGTTCGACGCGcaagcagcgactgcaggcGGAGCGCCAGAGCGgcggcaagcagcgcgagcaggcGTCGGTTCTGCGCGTCCAGAACTGGGACGCc
gggctgctggagagcgcgGCGTACGCGGGCAAAGTGGTGAAGCGCCAGGACCTGAGCGACGGCGCGCAGTCGCCCGACGAGGACGCGATGGCCGCGTGGT
CGGACGCCGAGCCCTTCGgcgcctcggacgaggaagaagaagaagaagaagaggaagaagaagagggggaggaggaggaggaggaggagagtgacgacga
caacgaggacATGAGCGCCGAGACGCTCATCCGGGGCTTCCAGAAGGAGGACTCGGCGCGGCTCATGGGCGCGCAGGACAGCGAGAaggtcgtggagaag
gccaagcacgTGCGTCACCAGAAGATCCTCTGGGAGCGCTGTCTCGAGGCGCAGATCTACACTAAGCGGCTGCTGATGacggccaaggacgcggcggctC
ATGCCACGGACGGAGAGACGACGGATGAAGACGCGGCGACCAAGTCCAggcagcaggtggtggcCGAGCTCTACACGAGCATCGACGccgtgtcggtgct
gcagaagaagctgtgCAACGTACCGGAGCTGAGCGCTGCGGACgcgccgacgaagaagcgcaagcgcgcgTGCGACGAGCTGTGGCAGGAGATCACGGCC
AGCAACCGCGCGATGCTCCCTCAGTACAACGACATTCTCAACACATACACGCGCAAGACGGACCTGGCGGCGGGAGGCAAGAACAGccaggccaagaagt
tcaaggcTGTGAACCAAGACATCCTGGCACAGGTCGAGTCGGTTCTGGTGGACCCCCAGCGAGTGAAGCGAAAGGCGCACGCTCCGTTGGACGTACCGGA
GGCCGAGGCAACAGAGGCATCCGAggacctgctggacgagctcatgtacgacgactcggacttctaccagcagctgctgaaggagttTATCGAGagcggc
gggggcggcgctggccaggaCGCCATGGTGAGGCGCACgcaccgcaagaagaagaaaatcGTCAACCGCAAGGCCAGCAAGGGCCGTCAGCTGCGCTACA
CGGTGCACCCCAAGCTGGAGAACTTCATGTTCCCGGAGCCTTACCCGAAGCCGGGgatggacgtggacgagctgttccGCTCGCTCTTCGGCCAGATTCG
GCAGTAGACAGCTTGATATTGACACCTTAACGAAGAATAGACTGCTTTTGATCGTAAAGTGCTTGCTTTGTTAGCATGCTTAGAGctatcttcttcttct
ctaGAAGATGTAACGCGCAAATTATTATCCCTTCCTACGCCACACGATGGCGCGCAGCGTTGTGTTCTGAGGTAGACACCTCAGTTCCCTTAGAGCacat
cgtcttcttcttcctcttcctttTCACCTGATAGGTGCACTTCCTTGATCTTTGCTGAGGTTGCTTCCACCtcacgcagacgcagctcaTTGACTCCTTT
CGCACCGATCTTCTTCACAATGCCGACTAGAGTCACCGCCTTCTCGGCAACGTGCACGACGGCCAACGCTCGGATTTTCTTGGCTCGTGTGGCATTTTCC
AACGACCGAAACTCCTCTTCTGCCAAGTCCATCGAGGCATCGGCTAGCACCGCTGCAGAGTCGATGAGTTCTGTGCCACGCTCCTCAAAGCGCTCTGGGA
TGTTGAACGTGTGCAATTGACGCACTTCCGCCGCGTACGAGCTGCTCTTAAATACTTTGTGTTTGAGCTTCACTGCATCCTTCAGTAGCTGTGTGAACTT
GTCGATCAATTCCGGTTTTCCCTTGGCAGTCGCGCGCATCGTAGCAGGGGCGTTAAGAATTTGTGCACGCTTTGCGATCAACTGCCCAGCATCGCGTTCC
AAAAACGAAAGCCCCCACAGCCGTCCGTACGCCTTACCGGCGTCCAGCCGCTCCTGCTCTGAGAAATACCAGTCTCGTGTCTCCTTATTCTTGATCAGCA
GACGCGAGGACCAGGTTTGAGCCGAGTCAGATCCAAGCGCAAGCCCATATTCCTCTAGTTTAGGAGCAATTGTTTTGCTGAAGGCGATCGCCTCTTCGTC
GGTAGACAGCTTCGTAGTCAGGAGCTCTGTCACCAAGCGATTTATCTCCTCAcggttctccacgagcttcttgttgctctcCTTTCGCGCTTTCttctca
agctgctcgatcaTACCCATGCCACCAGACCCCTTCGACTGCTGGGATTCGTCGCCAaagatgtcgtcgatggcaCTTTCCACAGCAGCTAGCTCTTGAG
CCATTTGGTCTTCCACTGATCGCGGCGCCATACCACCCACTACACTGCCTTCCCCACTGCTACCATGACCAcgtgcaccaccaccgcctaATCCACTACC
ATCTGATACTGCATCGATCACGAAAGGATACACACGCAATGTCAGTACATGATCAAAATGACGACAAGTAGATCGCAACACCACCTCACCTCGCTGAATG
ATCTGCTGGTGTTGCATAAGAATGCTGAAGAGCTGCTCCATTGAGACAGGTCCGGTAGGAGAGGCTGGGGCTTGAGCAGGAGGCTAGTGAGCGCAGTGGG
TAATGTTGAAGTCAGTTAAGGCACAACATACTAGCATACAGCGATTCAAAACGTACGCCAGGGTCGTTGGGTGACACATCATCGGGAcgatcaagcagct
cagGGTCCACCTCCTCtgccttcatcttgagcttgatctgctcgtcgGGCATGCCCATTTTCCGCAGCTTGAAATATTTGCTGAGCTTCGGGTCATCCTT
GACATATAGTGGCTCGTACGGAACGACGGGGGCTGCAGCGGGCATTAAGGGCCAACTAAAGGCCCCGTTTGCTCCTTGTGGTGGAGATAGCGGTGCCATC
CCATTCGATGGATACCCAGACGAGATTTGCAATGGCGGCTTTTTATGATACCATAAAGCACAAAACGCAGCAAAGCTGTCAGATTCCAGCACATGCGGCC
ATTCAAGATCGCTGCAAACGTACACCAGGGTCGTTGGGCGACACGCTGTTCGGGCTGTCCAGGAGTTTCGGGTCCACGCCGTCAGACTCCATCTTCAGCT
TGATCTGATCGAAGGGCATGTCCATGCTCTTCAGCTTGAAGTATTTCTTGAACGCTGGATCGTCCGCCACGGTCATCGGGATGTAGGCGCCCTTCTCCGG
CTGCCACCAatcaacaacagcaacaacagtcAAAGCTTGAGTTCATCACCTCGGCACCAACATGAGAGGAGAGGAACACATCGTCTACGTACGCCAGCGT
CATTCGGAGAAACCGCGTCCGGCGAGTCCAGCAGATCGGGGCTCACGCCAtccgccttcatcttctccttgatctGCTCCGTGGGCATGTCCATGCCCTT
CAGCTTGAAGTATTTCTTGAAATCCGGGTCGtccttcaccagcagcggcgtgtaCACACTCCTGGCCACCGTCAGCACGCCCCCCGCCTGGGGGGCGtac
tgcgtcttcttctccagctccgtgagcttctgctgcagggcCTTGATCTCCTGGAGACTGGTGCCAGAGGCTCCTCTCTCCCGCGTCCCTCCGCTTGTCT
TGTCCGCCATGAGCTGCGAgatctgcagctggagcttgtcaatggacgcgctggtggtgcccgCATCCGTTTTGGCCGCtaagtccagcagcttcttgat
ctgATGAGGCGTGAGGCCGGGGACGGCGAttccgccgctgctgccaccgcctcgGCCGGCAGACAACGGCGCGTGTGCCACGTCTTCACTCTCcgagtcg
ctctcgtcctcctcctcttccgattcttcctcctcctcctcggccgcctccttctccatccgCATCTTGATGCAGAGGTTGCGGTGCGCGCGCGCGTGTC
TCCGCTTGCACGTCTGCTCTCTCAACAGTCATAGCGCGGGTGTTCCGGTTAGTGATAATCCCAGAGGCTCCTTCTTATTATAGTCTTATTCTGCACCTCG
TTGCAGTAAATGGCCTTGCTGCAGATGGTGCAGGGCAGCGAGGCGTTGGGCGACGCGCAGTAGGCGCAGTCCTCGCCCGAGCCGGCCGCGAAGCCCATGC
CCATGCTCGTGAGGCGGctcatgagctcgtcgtcgctgtcgctgtccgcCATCGTCACTCAAAGTGGAGCTTCTCGAGTGAGGCGTGCCAGTTCGTTTTC
TCAAGTTGAAAGTCCCATAAATAACCAGAAACGGGGCGGATGATGGCCCAGCTTTTTGTCGTACAGTCCCCAGAGTATTGGCTGGGCGGCCTGGATATTT
TGGCGCTCGCTTGATGGACATCGACCCCGAAAAGCGCGCGGAAAAACCCGACCAGCAATTGACATTGTGTCCAAATTTGGCAAGTCTAACGAGTCTCGTG
CTGGGACGATCCTTATACTCTGCAGACAGAATGAAattgcgctgcagcaggcggatACACGTCGAGGGAGATCTCTGTCAAAGAGTCTGATTCCCGTTAG
AGTACAGTGTATTTGCCAGCCCAGATCACACCGAGACtttgccacttcaacttacAGACGCATCAAGATAATCAATCAACAAGATCGAGTTGGTGAAAGT
TTGTCATGTGTATTGATTGCTCTGATGAATAAATATCGCGGCATGAGGCCGAGTTGTAACGGAGCTACCGAGGCTCCGTGTCCACGCTCTTCGATCGAAA
CGTGGctggccgctgctgcttgtatAGATAGGGGTTTGCTGCCTTTGGAAGGAAGAGGACTGcacttcgtcctcctctAGGCTGCTGCGCGGGACAAGCG
GCGCTGCGAGAGCATGCGCACCATGTCCGGAGACTTGCCAGTCTCACTGATGTTGAGCAGGAAGTCTGATGCCACCTGCTCGTTGGTGACGATCCCCGAG
AACCGCTGGAACAGCTCGCAGATGGTGGCGTGGCCGTTGGCCTCGGCGATCATCATGGCGTCGCTATCGTTCTTGGTGCGCTTCTCCgggtcggcgtcgt
ggcgcagcaggaactcggaGATGGCCAGCGATCCCAGCTTGGCCGCGAAGTGCAGCGGGGTGATGCCACTAGCGGTCATGACATTCACGTTGGCACCATG
ATCCACGAGCATAGATACGATCTCGATGCTCTGCGAGACAATGGCGGCGTGGAGCGGATACGtgccgcgcttgctgcaGGCCGACAACTTAGCGCCAGCG
TCAAGCAGAAGCTTCACGGCGTCGACGCACCCGTTGCGGCACGCAGCGATCAGCGGAGTGACACCGGCGTCGTTGGCCTTGTTGGCGTCACCAccttcat
ccagcaggagCGCCACAATGTCCGTTCGACCCATGCGAGCCGCAATGTGCAGGCACGAGGAACCGTCAGCCATAGCAGTGTTGGCTTCGGCGTAGTTGAA
CAGGATGAGCTGCACAGCGTACGTGTGGCCGATGCGGCACGCCACGTACAGGCAGATCTCCCAGCGGCGAGACTGGGAGAGTTCGGGCGAGTTCAGTTCA
TCAATGTCGCTGGCGAACTGGCTCAGCACGTGCTCGCAGAACTCTTCCATGAACGAGTGCATGGTGTGAACGCGCACGGTCTTGACCTGTAGAGACGGAA
GGGTCACGCGCTCGGGTTCTCCGTCCTTCTCTTCACTTGGAGAAGACGTCGAGTCCTCTTCAATTCGAGGCTCGACTGCGCGTGGGGCGGCGAGGTGAAC
CTCACTACGCTCCGGGACGCTGTCCGTGAAGCCGCTGCCATCTCCCCCCCCCTCGTCTTGACCCAGCATCTGGTCGGCGCATTGCTGCCTCCAGCCATTG
AGGGCCAGAGGGCGGTGCAGCACGGCCGATGCGTCGGCCGGGAAGTGCTCGGCTGCTCCCAGGAAGTTCGCGTAGGTCTTGAGCACCAAACAGCTGCCGT
CCTGCAGCTTTTCACGCAATGCCGAGCTGGCAAAGGTGCCGAAGAACTCGTGTAAAAGCGCAACAAAGGCCgcgagcgcgtcgcggcgctcgttGACGGC
GGCGTGGTCGAGACCTGAGAGCTTGGAGCGGAGCGAGCGGCGCGACGGAAACGGgaacgactgcagcatcgggtgcagcgcgtcgaactCGCAGCGGCCC
TCGGCGCAGCGGCACTTATGCGCCAGTCCGAACGGCAGGCGgtgcgcagctccggccGGTTCGTTCACGCGCTCACGGAGCGTCTTCCAGAGGCGGCGGA
ACTGCGAATAGGACCGCAGCGTCGTGCAGATCCCGTGgggcgagggcgacgccGGGACTGGCGCGCGGGCATCGCTCTTGGTGAGCTtgatggcgaagaa
gacCTTGCCGTCCGTGACCTGGTAGGCgggcacggccacggcgtACTTGTCGATCCAGCTCATGTGGCGCGATGCTCAGGCGTCCGAAAGGGGAGAAAGT
GAGACTGGTTTGGCTTGCTGGCTGGCTTGTGTCGCAGGTGCTCGGTCAGTGGGTGACACTGGCAATTATTTCGCTGGGAGCAAGAGCTCCGAAGCGAGGT
AAATATAGCTTGAGGATACGAGTCcgctgcgagcagcacgactGCGTGGGCTTTTGACCGTGCTGGCAAAAGCGCGAATATGGTCTGCGGGGTGAGCTCG
CAGACCGTATTCGTAATGCGTGTCACACCCCCTTGAACTCGCCCGCCAATCACCGCACGGTCCCCCCTCCGCACCGGCTCTGGAGAGGCGCGAGCTGACC
AGGCCGCGCGGCGCCACGAGATCACTAACTAAGCGGCTCTGGCCGTGCAATTGCACACCAGGGGACGATGAGCAGTGGAGGAGGCCCGGGCTGGGCTGTC
CAGCCCTGGTGCAGTAGAAGCGTTCGCAGCCGCAAGCTCGCGAAGGCCGCATCGATCCCAGCACGCAAACCGCACCCCTGCGAGGAACGTACACTTGAAG
CAAAGTTTCGGGGCTCGTTAGCAACTTGCAAAGGCTCTCGGGGAGGAAAATACAATTGATGGTGCTTGGTGCGTGGCAGCCGATGGATTTTCGCAGCGTC
CAACTCGCGGGCTTTGCCCCAGCCGGTACTGTATTACAATAACGTGGTCAGCGAAGTTGAGGCGCGTCAGGGGCCACAGCAAGTCCGTCCGGTGCACCGT
TTTGAGCTCCGCTGCGGACTACAGTCAAACCGTGAAAAACCGCATTGCCAGCGGTGGATTTTTGATGAACAACATCCCGAATTGTAGAATCGCGACCATT
CGTGCGACTTGAAAAAATTTGGCATCGCCGTACGTACGCACCTGTCAAGTCCGCGTGTCTAtgtttgcagcagcaacgtaGGATCCAGCCATTCCGCCAC
AACGTGcattgtacatgtattagaAAGGTTGACACGTACACTTGGTCGACGTGCACGGAATCCTTGTATTTTAATATCCGAGTCCTCGATAGAATGGGGC
AAAAAAGTTAGTTCAGTAAAAAACGATACGTACACTCACGTTTGCATGTGTAACATGACCACTGAATTGCCATCTTCGTGTGGCTCTTCAGGTTCATCGG
AGACGGGGCCGGGGTGGGGCCAGACAGCGCGATGAGCTCGTTTGGGTGGTTCCCAATTGGTAACGTGGACTTTCCCTTCAGCTGTCGGAGCTCCAACCTC
AACTCCGCCACCGAGATCTCGTCCTGGTTGCAACTCGTTGAAGTGATTGCAGCGCTTTGCATCTTGAACTGCTGGGGGCGTTAGTGCACTCGATGGCGGC
TTACCtgcctcgtcgtcttggaACGAGACCTGGTTCTCGTGGTACGAACTGCTCGGTTAGACttgcttcctcttcttgaCTCGGCGTCAGACCTCCCAGA
GCTGTTGCCTCCTGCTAGTCTCTCGGACCTTGCTTTTCAAAAGCTGCAGTGACTGAGCTCGTGTCTCGCAGCTATCAAATCGAAATTGCCAAATAAAAAT
AATTCGGTCGCGTCTCTTCGAATGCTCGGCTGTTCAGCCTTGGTGGCACTGAAGCACTTGCTTGCCAGATGAAGCACCTGCTTGCAGTACTGGCAGTCGT
GATCCCCGCAACTGAAGCACTTGCTTGCAATGCTGGCACATATTTCGATGGTACCATTTCGAAGTGCTTGCGCTGTCCAGGAGGGACCTTCGGTTCCGTG
CCAGGTCTCACTTCGCCAGCGTGCTCCGGCCTGTGCACTGCTGGGTTCTTCTGTCCGGAAGGTTCGACTTCCGCGATCGAGAAGCCTTGCGGCAATTCCA
TCTTCTACTGCCCACGGGGcagtgctgcacgacgcgaCGTGGACACAGGGTACTATACCAGCACATTTCCAACCGAGCAGACCAATCTGCCACTGACTGA
CAGCTCCaaaggcggcgctgcacggcAAATACGCTGTGAGAAGGGATACTACTGCGTCTTCGGGGTCCGGCGAGTTTGTCCTGCTGGTGTGTTCGGAGAC
TCGACAAGGGTCACCACGCCAGAGTGCTCGGCTCCATGTCCGAAGGGCTCTTACTGCCCTGAAGCTACAGCCGTGCCGATCCCTTGTCCTCCTGGTACGT
TTGGCGGCGAGATTGGTCTAACGAATGCTCAATGCAGTGGACTCTGCCCAATTGGTAGCTACTGGTGCGTTCCAAAGACTTGCACGTGGTTAATGCTGAT
CACTTTATATTTGTTTTACCTTCTCTTTATTTCACGTCACTTTGCAGTGAGCTTGGAACGAgcacgccagcgccatgcGCTGCAGGGTCGTACGGGGCGA
CGCAGGGTCTCATCAGCTCGGCGTGCTCGAGTACGTGCTCTATAGTCAACGGAGTGCTGTCGTGTCTCCCCTCACCGTGTCAAGCGGGGTACTACTGCCC
ACTCGCAACTAAAGTACCGCTCGAGTGCGGAGCAGTAGGCGTGTTTTGCCCAAAAGGCTCGTCGACCCCAAGTACTGCAACAGAAGGTTACTACACAACG
TGGAAAGCGTCTGCAGGGATATCCATAACAGGAGAGCAGCTAGCACTGCAGTATGTCGAAGGCAACCCTCTGGCCGCTCGAAACCAAACCACTCGATCAG
AGCAGCACATTTGCGAGAAAGGTTCGTATTGCACTGCCGGCGTCCAAATACTTTGCCCGGCCGGGACCTACGGTGCAACCGAAGGCTTGTCGACGGCTGC
GTGCACGGCACCATGCCCCGCTGGGTTTTACTGGTAGGGAAATCGCTGTCACTGCTTTCCGCGACCTTGGTTTTGGACGAACTAACATTTGCACTGACTG
ACATGCTGTAGTCCGATTGGAACTGCAGACTACAGCCAGCACCCGTGCACACAGCGGACATCATTTTGCCGTCAAGGTGCTTATGTACCAACCGCTGTCG
GTACCGGATACTTTACGGTGGTGACGCTAGCGGGTCTTCGTACCGACCAAACCATTTGCCCACCTGGAAGTTTCTGCGTCGGCGGTATTCAACATCTTTG
TCCTGAAGGCGCGTACGCTGTCGCTTCCGGTCTTTCGTCTAAAACGTGCAACGGGAAATGCCACGACGGATACGTGTGTCCGACGTCAGCAAAGGAATCA
CCCTGCCCAGCGGGGACGTACTCGCGAAATGGCAAGTTCTGCTCGCCTTGTTCTCCCGGGTACTGGTGTGGCGTTGCATCTCCAGaccccaagcagcacg
agtgTGGTGCTGACAACAAATACTGCCCACTTGGGTCGTCAGTAGCGCAACAGGTGCTTGACGGCTACTATGCAGTAGGGCAGCGTCTCAACACACACAC
CTCGGAGGCGTTGTGCGTCACTCGAAATGCTCCTCACCTTCCACAATGTCCTACAAGAACCGTAGGAGTGAACGGTAACATTTAGCACTGCACAAGCAAG
GTCTTATCATTACGTAAGTACAA