Description :
From Genome Similarity Track
Location :
Scaffold_676:3192- 4761
Sequence
1569 bases(100 bases per row)
ATGCTGGTGGTGATGATGGGCGTTGTACCGCAGATCGAGGATGCGTACGCCCGTGAGCATGGAGACATCCCGCACAGAGCGACAGTCGCTCAGGTTCAGC
ACGTGGACGCGTGCTAGCGCCGAGACATCACGCACGTTTTCACAGCCCGACAGGTTGAGCGAGTGGAGCTTCCCCAGCGCCGAGACATCGCACACTTTCT
TGCAGTGCTTGAGTGTCAGTGTATGTACCGTCGCGAGCGCCGATACATCCTCGACCATGTGGCAATAGCTCAGATCGAGCGTGTGGACCCGGGCGAGCGC
CGAGACGTCGCGGAGCCGCGGACAACCAGCGAGCTTGAGCACACGCACGTTACGCAGTGGACGTACGTCTTCTAGTGCGTCGCAGAATCGCATGTCAACT
TCCGNNNNNNNNNNTGGACAACCAGCGAGCTTCAGCACACGCACGTTACACAGTGAGCGTACATCTTCTAGTGCGTCACAGAATCGCATGTCAACTTCCG
TGGCGTGCGCCAACGGAGTGACGTCTTGGATCAACGGGCAGCCCGACAGGTTCACACGACGTACACCAGCAAGCGCCGAAATGTCGCGCAGTTCCACACA
GCGGTACGCGTTGAGCACGGTCACACCTGTGATTCTGTCCAGGGTTTCCAGTGCGCGACAAAAGCTAATGTCTAGCTCATAGACATCGCGAAGTCCGTCA
AGGTCCTGGATGAGCTGGCAGCGGCTCAGCACGAGCTTGCGCAACCCACGCAAGTGGCCGACGCGAGCAATGCTTTTGGAGTTGGAGATGTCGAGTTCTT
GCAATTTCCCATTGACGCCGAGCATTGAGATATCGGAGACAGCGTCGCAGTTGCGCAGGATCAAGACTCGAACGCCCACGAGGGCCGAGACGTCCCGCAC
GAGCTTGCACATGGACAAGTCAAGCGTGTCCACGTTTCCGAGCATCGAAACATCCGTCACGTTGGCACAGCCGCAAAGATCGAGAGACTTTACACCGCCC
AACGCCGAGACGTCATAAACACCCAGGCACTTGCGCAGCTTGAGGGTGTGGACGTTGCCCAGTGCACTCACATCCGTGACGTTGACACAGCCCGAGAGCG
AAAGCGTCTTGACGGCCCCTAACTCACTCACGTCGCGAAGACCGATGCAGCCGCCGAGGTTGAGATCTTCGACGTGTCCGAGGCACGAGACGTCGCTCAG
CTGCGGGCAGTTGCGTAGATTCACGCACTTGACGCGTTGTAGAGGAGAGACATCGATGATACCCCGACAGACGTTGAGATACACAGCTTCGCACGAAGCG
AGCGGTGCGAGGTCGGTGACGTTGTGGCAGTACGAAAGATCCACGGTCGTGGAATGTTGGAGGAACGACACGTCGCGCAGTTGGTTGCAATAGCTCAAAT
CCACTTGCGGGATGCCGTCGAGATATTCCAGCCTATCCACGACGGCGCAGCCGCTGAGATCAAGCGACTGCAGCTGGCGGATCCCATCGAATAGTTGTAC
GCGGTAGATGCCGGAGAGGTTGAGGTGATGGACTTGTCCCTGTGCAATTGCCTGCTTCAGAGTCGAGGG