Description :
From Genome Similarity Track
Location :
Scaffold_16:319147- 331165
Transcript NameFunction/comments
Phyra_94393cell division protein ftsZ
Phyra_76148glycoside hydrolase putative
Phyra_76149acyltransferase domain containing protein
Phyra_94396conserved unknown protein
Phyra_94399M96 mating-specific protein family
Phyra_94402glucokinase putative

Sequence
12018 bases(100 bases per row)
GTGGGATGCAGCCGTTCCGGTTTGAAGGCAGCAACCGTGCGAAACTTGCGGAGCAAGGTCTCGCTGAGCTGAAGGATAGCGTGGATACGATGCTTGTGAT
CCCGAACCAGAATCTGTTCAACATGTCGAACGAACGAACGTCACTGATGGATGCGTTCAGGTGCGTGGCATGGCCTATCACTCCTGGATGAGGATTTACA
TTGCGATTCAGCTGAGTGAAGCTGACGGTTGCTGCGTGCCTGGTACATGTGCTTAGAATGGCGGACAATGTGCTCCTTGATGGCGTCAAGAACATATCTG
ATCTTATGGTGATGCCTGGACTCATTAATCTCGATTTCGCGGATGTGCAGTCGGTATGGCTCTTACTTTTCCTTTGGTGACAATCTGGTTAGCGACTTGC
TCATTGCTTTGTTTGACACTCAACCACAGGTGATGCAAAACATGGGAAACGCCATGATGGGAAGTGGAGAGGCCGATGGAGACAACCGGTGGGTTTGTGT
ATTGGCTGGCTGCTAATGAGATGAAATTGGATCAGCTAAAGTGTTATGGTTGCGCTCGTTTGTTAGAGCTTTGCGCGCTGCTGAGGATGCGTTGGCGAAT
CCTCTACTGGGAGACATTTCAATCAAGGTACTTCCTCACGTGTACATGCTAATCCGTGCTCGTCTTGCTCACGTGCTTCTTTTGCGTCGGCAGGACGCCA
AGGGCATGATTGTAAACATCACAGGTGGCTCCGACCTGACGTTATTTGAAGTTGACGAAGCTGCTGAGCGTGTGACCCGGGAACTTGACGACCCACACGC
CAACATTATCTTCGGCTCGACGTTCGATGACTCCCTCGACGGTAAGCTCCGCGTTTCCGTGGTCGCAACTGGCATCGCCGACCCCGAAAAGTTATAGACA
CCGAATCGCGAGCAAGTGCAGTCGAACCAACAAGCGAAAAGTGAACCTCAGTGACGTGTGGATTGAGTAAGCATGCATAAAGTCAATGCTAAACGCGATT
ACCCGTGTGTGCTGATCGCATTGATAATATACTGACTGCTTCATACTTAGTTTGCACAGCACCCTGCCCGCGGGGCGATGCGGCTCTGCTGGCCGGCTTA
GCAGCTACCCTCGAAGTGGATAAGCAAAATTGCACTGTCCAACAACACACTCAAAACGCGTATTCCTTGTCGTCTACAGAGAAGTTGGCTTGCTGCGATA
GCCGCTCGGCTGGCAAGGATGAAAGTGCCTCCTCCAGATCGAACGAGGCCCACATCGACGTGAGCCGGACAACCACTTCTTCGCACGTAAGGCGAGCTCC
CTCGGGCACCACCACCTGCTTCATAGCCTCCTCCAGAGGAATGCCCTCATCGTAGCACCGTTCGTCATCGTACTTCTTGCCGTAGCCATCGTCGTCACTA
CTGTCTGAATAATCCATGATTGGGTCCTCCGACTCGTTAGGCTGCGTGGATGCATCGTCCGACCGAGTACTCATCATGGCCTTGTTGCGAGAGAAGATGG
ACGTGCCGCCCGAGACCTGACTGTTTGTGAAAATGGGTTTGCTCGACGACTTGCTGGCGCTGAAGAGCTCTTTGCCTACCAACGAAGGAGAAATGGGCGG
CGCTGGCTCTGGGACGGGCATCACCGGCTGGTCCACCACCGCGTACGAATCGAGCGACAGCGACTTATTGATCTTGGGGAGGATGGAGCCGTTCATGGGC
TGCGCGCCTCGAATGAGAAACGGGCGCATTAAGTCCTTGATCTCCTCGCCGCAGATGCCGCACTTGGGGAGGTCGTTGTATAGGCGCCCCACAAGCAGTT
TGAGGAACTCCTGCAGCGCCGACACGCGGTGGCGAACCACCGAATTGGTCCGCAGCAGCGACTTGCTAGGGAAGTGGAACTTGCTGATGGCGCGGTTAAA
GCTGGCGCAGTTGGCGCACGAGACGCCGCGCGTGGCGAGCTTGTGCTGGATGTCCTTGCGCAGCTGCAGGAACTGCGAGTAGCGGCGGTTGACGGTCCAC
TCCTGGTTGGTGGGCTGCACGAGCATGCAGATGCTGTACAGCGTGTGCGTGGGCCGGTTGAGCGCCGCCGGGATGAACACCTGCACGCCGCTCTGGAACA
AGCTCATTGGTGGCTGGGCTGGGCTGTCCTGCGTCCGGTTCCTGCGCTACGCTACGCTAAATGGCGCACTGCAGTGGCGTCGCAATTCCGCGCTTTGGAC
AGGCGTCGCCGGCGTGGAGGGGGTATGGTACAACGAACAGCTCGGGCTGCAAGGGGCGGGGTTGTGTACGTCGCCTCTGAGAGTTGACGTGGGGCGGTTG
GCTGGAAAGACCGACTGCGGACGCACGAGCTGACGCTGGATAGTGCTGGGCTCCCCCACCCGATATGCGACCGGTCGAGGCGTGCGAAATCGGCCCGTTT
GCGTCGCCACGACAGCGTCAAAGCCCACGAGACCACCGCGCCACCTGGGGTTTGTATGATGTTTCAAGCGCAAGGGCTCAGGGGTCAAGACACAAGTTGC
GCACGTTACAAGTGTACTTCCTTCCTACTGAAACTGGAGCCACTGAACCAGCAGCCTGCTACAGGCCAGCAAGCACAGGCCGCAATCCAGGGCTGATAGC
AAAGTGCACTCTTCTCCTACGCGCCAGCCTCGCTTTCGAGCCGACACCGACTCGCGTGCGCTCCGGCTACACGTGCTGGTTGCAGCCGTTTGCTGCCTGC
AAGCAAGCAGGCTATCGAAAATCGTCCTCGAAGCCGCACGAGCTCGAGATCGCGAGCTCGGTGGAGCCAGCGCCTCGGTGGCAAGCACGCCGGTCCCACG
ATCATGCAGCATAGGGAATGGCCGCCCGTGCGTGCACGGCCCAAGCTATCATCGCTGGCCAAGAACATGGCGAGCTTCCAGCAGCACGGGCTCCGCTACC
GCTGACCGTTTCGCAGCAAGTCGCAGGCAACGTGGCTCGTTACGCTGCTGTGCCTGTCGCCTTGAGCGTCGATCTTGCTCGTCGACATGGTCCGCCCTCA
CTGCTGAGCCGAGCGGAGCGCTCAGTCTTTGCGATTGCTGACGGACAGCAACAATTTTCAGGTTGTGCTGTTGTGCTGCGACTGTCCACATTGGTGTGTG
AGCCACAAACCTTCTCAATATGATATTATCGACTTGCGCAGGGGTAGAGTGCGTATCCCACAGCAAAGGACCTTCCTTCTGGGATACTCGACCGAGCGTC
ATCGAGTCCTTTTACATTTCTCACCGCCGCCGAGCTTACGGCATTCACCTCCTCGCTGTGCGTCATTGCACCTTTCATCGCGCCGAGCTCAGATACACAG
CAACAAACATGCTGTCGACGCTGATGTGGGTCGCGCTGGCGGTCGCGGTGCTCGTGACCCAGGGCTACATGATCGTGGCGCGCTTCCTGCGGCTCTTGCT
CCACACGTACTTCCGCAAAATCGTGGTCTACGGACTCAACAATTTCCCGCGCGAAGGGCCCGTGATCCTGTGCCCGAACCACCCCAATATGCTCGTGGAC
GCCATCCTCGTTATGACTGAAGTCATTAGCCACGGCCGTAACCCGTACGTCTGGGCCAAGGGTTCGCTCTTCAGCAACGCCGTCGTCGGGTTCCTCCTCA
AGCTCTTCGGTGCTGTGCCAGTGTACCGCCCGCATCGCAAAGAGGACAGTCTGGCAGATGTGGACTCGAACAAGACGCCAGAGGAACTGGAGGCCGCTAA
CCGCGCCATGTTCGAGCATACGTGGCGTGTGCTTGCGGAGGGTAACGTCATGGTGCTCTTCCCCGAAGGAACGTCCTACACAGCGCCGAAGATGCTGTCG
TTGCGCACGGGCGTCGTGCGCGTGGCGACGGGGTTCGCCAAGCACTACGACCAGCCTATCCCGGTCATTCCTCTCGGGCTCAACTACTTCAACAAGGATC
ACTTTCGGAGCCAAATGACGCTGGAATTTGGCCCACCCATGCTGATTACGCCCGACTTGGTGCAAAGCGACGCGTTCCAGGAGGATGAACACAGCGAGGT
GAAGCGCTTAACCCATGAGCTGGAGGAGCGAATGCACGACGTTACTCTGAATGCGTCTGATTTCAGCACCATCCACGCAGCGCGAATGATGCGACGTCTC
TATCTGAACACGCCAGGGTCCATTGATGCCAATAAGGAGGTTCGCTTGACGCAGTATATTATTAACATGCTGGAGCAAGAGCCTCGCGACGACGAGCAGA
AGAAGCGCATCGCAACAATTCAAGAAAAGGTATTGCGATACAAGGACGAGCTGGACAGGTTGCGGCTGAAAGACCAAGAGGTGAATTTGCCCGTGCCAAA
GGAACAATCGCTCTTGCAGCTGTTCTTGGAGCGAATCCTCTACCTGCTTGTCTTGCTGCCATTGGCTACACCCGGACTTTTGCTGAATTTCCCATACTAT
TTTATTGGTAAGTCGGGTTGTTTGCTTTGGGTGACCTGTGCTGGTAAGATGCTTGAACTGACATCTTCGTTGCTGTGCTGGGAATCAGGAACGAAGATGA
ACAGTCTCGCGGGATTCGTCGAATCAAAGTCCATGTTTAAGATCTTCGCTGCAGGGTATGTTAGCTACTTGCCTTTCTAGGTTCATGTTGCTGCACGAAT
GTTGCTAACATGTCTGTTGTTGTTGTGCGCAGTGTGTTAGTCCCCGTTCACTGGCTGGTGCTCATTCTTGCAACGTGGTACTTTCTTGGGTCTGCATATG
CGTACACGCTTGCCGTGGGGCTCCCACTACTACTTTACTCGCACATTCGTGTGCTGGAGGAAAGCCGTTCGATAGCAGAGAATGTGTATTTCCTTTTCAA
CATCACGGCCCATGCAGACCAGGTCGCAGTGCTTCGTAAGGAGCGGGAGCTGTTAGCAGAAGAAGTACACGAGCTGGTTACCACGTGCGTGGACGCCAAG
TTTCTCTCGGCCGTGCACAAGTCTATCGCAAGCTCTCCAGGGAAAAATCGGCTACGCCACCGCGCCTCCTCCACCAGCGACACCCTGCTTGCAAGATGAC
GACACCAGAGTGGCTAGAAACGTTTAACGAGTTCGTTGCGATCTAATGTATCTTTGTGACATTGGTCAATTGTGTTGCGCGGGCCTTCCCACCTTGAACC
GAGTGACGCAGAGCCGACAACAGTCGTGACGTAGTGACGTCCGGTTTCTCAGGAGCACCCGTAAGCAATGTGATAGCGTGTGAGCCCAGGTGTGCTCGAC
GGCGGACTCCAAGCGTGCTTGATTCATTCCTGTCTTTAGCTAATTGCGGAGCTCTAGTCCGACATCATGCCGTTTTTTCTCCTTGTTTTTCAGCTCATCT
GCAACATCACAACACAGGTAAGCCTACCCGCTGCTGCAGAAGCAGTAAGCTAACAGCAGCAGCAACGTACGCTTCTTGGTCTTGACAATGTTATCTCGTC
TGTCCAGGAAGAACACATTGGCCTTCTTGGTGTAGGTCGTCTGGTACCCACAAGCACAACGACAATAAAGTTACCCAATCTTCATAAACAACCCCGCCCC
ATCCAAAACCGCTTTAGAATCGATGTAAACGCACCCTCTTCGGCTTCACCGCGTCCAGCTCACTCAGCGCGACCTTCAGCTGCTGAATCTGCCATTTTAA
ATCACGATCCATTGCCGCCAAACTTGTCAGTACAATTGTACTATGCACGAGACCAGAATGTCCACCACTGGTAGCTAACGCACCTCTCCATCGAGCTTGT
GGGCGATCTGCTGTGCTTTCCAGCGGTCGTCGCCGCCGCTCTGCTCCGTCACCTCTTCAATCTTGGCCATCGCTTTTTCTGAACTTGGCCAAAAATATGT
GGACCACAAATGGCTTCTTTTGCAGAGCAATCAGATCAAGGCAATGAACGAGGAAGAGGAGTTCGGCATGAGCAAGACGTCGCGGGACGCAGACCCGATG
GAGCAGGAGCCCAAGGGCGCCGTGAAAGGCCACCCGGACTTTAACTTCCTGGATACCGACGAGATCCGCGCGGGCGTGACGTCCGGGGACAAGCGTGCTG
TGCCTCTGTGGATGACCAGCATGCCGGTGGAGAAGGATCCGAGCCAATGGTCCATTTTGGAGGTGCAAATCCGCCCCGACCGTGCGTGGGAGGTCATGAA
GGAGCTCATCGCCACTGTCTGCATCGGCAAAGGTCTCGTTCTGGAAGAGGAATGCGCTAATTCGGTGCTGTTCCGTAAGAAAGTGACGCAGGAGTCGGTG
GCCCACGGTATGGCCAATACTGCCACGTTTCTCAACGTGTTCGTCCGCATCGGCGTGTCTCCGTCCAAATTACGAGTGGTGGACATCTGCACGCTGGTGT
CGAATGAGAACAAGCTGTTGGGCGGCATGATGCCGACGGGGACGAGCGCTTTCTGGTCGACACAGGACCACAACGAACCGCACAAGTATGCGCTGGACCA
ACTGTTGGGGGCATTGCAGTCAACATTAATGAGCCAGTGCCTCTCACTGAGTTATTTGTACATGTCCACCCCAGAAAACTCCATGGATTCAGGTGCTGTC
TACTCGTGCACGGCTGTAGCTCTTTCTGAGTTGATCCTTTTTTCTTGACATCACTTTGTGGACTGTTTTCTGGATTGTACAGTTGAGAATGCAGAGCTGG
ATGAAGGATATGTTGCAGATCTGAAAAGAGCATTCAGCAGGTGGAGTACATTGAGGCTATTACTGTTGAAGTGATCGCTGGTAGAATACTAACATGACTG
TTTGTTATCTTTTCAGTGAGATGAAAGCAAACATGAGAGACCTGTGCATCCCGTTGGAATCGTATGCGTACGACCAGGAATTTGCGTGTGCGTTGCTAAT
CGGGCTACTGGAACCGACGTTGAAGAAATACGGGATCAACCTAAGTGATGTACGTGTAGAGGGTGAGGATCTGGAAAACAACACAGGGGAGACGGTTGCC
GATGTTGAAGTTCTTTCGATAAGTAAGGACGGCCCATCATTGACTGAAGAGAAGGTGCCTTGTCCTCATGAACCGGAGCCTTTGGACGCTACACCAAGAA
CCGACAAAACTCCGCCAAGTGATGGAGGCAAAATCTATGGAGAAGCAGTCTCTGAAATGGTGCAAAAACTGTGGAGGGTATGCAAAGAAGATTGCGAGGT
GAGAATCCGAGCGAAAATTGATGAGAAGCAACAACAAGTGGCCGCGCGAGTGGAAGCCGTGCAAAGCTTGCGGACTCGGGTAATTCGGGCTGTTATGGAA
GTGTAAGTTTTACTGTTACCATGCTAAATATTTAAAGCAAAACTGACCCAACGAAATGCTACAGGGATGGTGCTGAAGGTTCGAGTCTCAAATCTTCACC
TGCTGGTGACAGGTACGAACGAAATCGATTGCCAAATTGGTCTTTTCGTTCTCATGGGTGAACTCAAGCAAGTTTGGTCTGTACTTCGCAGAAATAATGT
GCTTCTATACGAGGCCTCTTGCATGGTGAATGGCATTCCTGTTACGCTTCATGTGACTTATGGGTACGGCTTGCACACTGTTCAAATGATGGGTAGTATC
CCGATCAAAATTCCGGTGAGCTTACGGCAGGGCTATGTATGATGTTTTGGTGCTTCGGTATAGCAACGTCATTTATCGGACCATGGTGCCTGTATTTGCG
CACACAACGGTAGTTCCGTTTGAAGATGTTGTAAATGTTGTCCAGACTACTTCGTTTGGCATTCAGGTGGTTTCTGTGGAGCTGGATTCAGCAAAACATA
CGAAGGGGGTCACAATTGCGATGGGCCTTGAAGTCGACCTGCTGTATCAACTTCTCCATGAGGTGAGCTGACGTATCTGTAAATAATTGATTGATTTCCG
CCGCTCGCTCACACTGCGTGTCTTGCAGCTTTTCTCCATGCATCAACGCGAGATCAGGGCAAACATTGCAGCCTTGCCGCCTCTCCAGCAACAGGAGACC
GAGATAAACCCGACCGAGCTGAGGAACATTCTGGGCTCTGAAGAGGAGGAGACGAAGGAGGACGAGGGGTCTCTAGCAACTGAATCAACAGCCTTGGCCG
CCGCTGCTGCAGCCTCTGCTGACAGTACCCCATCGGCCTAAGAACACTTGTGAATGAGTAATCAGTAGCGACAGCAAGTATCTTGCCACAAACATGCATC
TCAAGTGACTTTTTCGCCAAATACATAATTTATTTCAAATATTGCGGAGCTGACTCGCAACTTGCTGGGAAGCGGTAGCTTGCACAAATACTTGCTCGGA
CTCCCAGCTTAAAGGCGGTGCTGACGGTTGGTACTCATGAGCGAGAGGAATGGGATCAATCGTCGGCAGCGGGTCGTAGTTTGTGACCCCCAGCAACGGC
TCTTCCATGTCGCTCTCCATCATCGTAGCGCTCGGAACGCGCGCCATCTGATGGTGCCGCTGCTTCCGGAGGCAGCAACGGCGGTACAGGAAGCAGAAGA
GGTAGGAGCTGCACAAGAAGACGGCCACGAAGCACACGAGCATAGCATCCGCCCACTGCATCCGCTGGAGCCGGGCGCTCTGCTGCAGCGAGGAAGGCGC
GTCCGTGTCGATCCACATCTTGAAGCACGAATTGGCAATTGAGTTTTCTCGCACAAATTTTGGGTGGGACCAAAACTTGGCAAAACTCAAGTCGCCGCGG
ACAAGTACCATAAGTCATATTCGAGCTGCAACGTACCTTGGCATCCAAATGATCAATGGTTACGAGTGCTTGGGTGGTGCAAATGTGACGGGTTGCGGCA
CGATGGACCCTCTAATGCGCCTTACATATTACGGATCGTGATGCAATTGACCAATGCACGATAAACATGTGCAAATTCACTTCATTAAAGCGCACAGCAG
ACAGAATTACATCCATGGTCTTGTCACTTAGCCACTGGGCTGCCCACCACCTGGTCCATGAGTGAATTCTCGATAAGCTCCTGGCTGGCCGTGATGCTGT
TGGCAGCAGCGCCCATCATGAACTTGGTCATGGCTCCCATGACGGGGGAGTCTTTTTCTGGTTGCTCTTGTCCGTGCTCGAGCGACACCAACGAGCACAT
CTGAAGTAGACACCGCGGGCCGACGGACTGAGAAGGAGGCACTGGTGAACGCTTGGCGACAGCATAGCATTGGTGGCGGTGTGTCAGCCCTGCGAAAGGT
TCGTCCACCACTTCCAGAGGAGTTTTGATCGAGATAAACACCACCACAACACGGTCCTCCTCCACGTAGCGGCGAAGAACTTGCTTGACACGGAACATAG
CGTGCGTCGAGCCAACGTACATCTCCTTCGCGAAGTTCTCGACGATTGTATCAGATTCGTCCATGACCTACAGTGCACATACAAGTTCCAGGTAAGCAAC
GAAACTGATGCTGCTAGCAGCGACACTGTACCTTTGCAGTCTTCTCGTACACCTTGCCTCTGTGTTTGTCAGCGCCCTTGAAGTGGTCCCATACCGCCTT
TGCAGTGGTGTCCATATCAAAAGGAAGCACTTTGTTGGAGAAAACGTCCAAATAAATGCCATCGTCTCCATCACGCATTTGGGTGTCTTTATATGTGACC
TCCATCGAGTTCAAGCCATTTGTGCAGAATACAGCATCCATCTCGCGGTATGCACCCTCCAAAATCACAAGCATATCTTCAAAGTCGCCAAGATCCGACT
GGTAGTTCACCATACGACCTACCGCGAAATCGGTCGTGTCCGGCGACACAGTGCGAGAACACTCCATAAGCTGCACAATCAGCACGACTTGACGTAAGAA
TCCAAAACAACTACCAAATACAAACAATAGCAGCCGCCATTACCTGATTCTTTGCTCGCTTGAGTAGCAGCATCTGCATGCTCTTGGCAGCTTTGAGTTG
GCTCTCCAGCACGAGTTTCAGCCTCGCATTCTCGATCTCTGCTTTCTCCCTGCGCTTGCGTTGCTGTTGTGCCACAGGCTTCCACACCGATTGTTCTGCA
ACGGACGAGGGCACCAGGGCGCCATCATGGCCCGCACTTGCATCTTCGTGCCCATCCTGCTTGATCAGCTTCACGGACGTTCTGTGCTGCTGCAGAGTGT
CCAACTCGGCCTCCAATTGGGCCACTTTCTCCTTCAAATACGCCACCTCAATGCGGCGTTCGTTCCTGGCCCGATTCGAGTCGCCAGTCACCCAACTCTT
GCGCAGCAGCTTCTTGGCCGTCGATCGCCTCGGCGCTCGCGTGCGCTTGGGCTTCTCGCGCTCGATACGACGTGGCGACCCGTCCTCGTCAGTCGTTGTG
TGGTGGTTCTCGCTGTTCGACGCCGGTGACGACATTGCGTTGGGGTTCTGAGGCGACGAAGCAACCGACGAGGGCGAACCCGTGGAGCTCGGGAAGCCCA
ACGCCCACTCCATCTCCTGCTTGTTCAGCACCTCTAGGGGTTGGATGGGAATGGGCGCGTCGCCGTTGCCGTCCGCGAACTCGTCCACGAAGGACAGTGC
AGCTTCGAAGGCCGCCATCTCGTCGTCCGCCAGGAACGCCATGGCATGTGCTTCTTTGTCGACGCTGTTCAATACTGAAACATGAATTGATTGCTGAATT
CCGCTGGTGCAGGTTTTCGGTCAATGGCAGGCTGTCAATGATCTGGATATCTACCAATGAGTGCATTGTTGGACCTAATTGTTGAAAAAGCAACATATCC
GCACTGAACCAGGACGCGGCATGGATCGGAGAATCTGGTTTGAAAGTGGACGTGAAGGAAAAGTATTAGTACGCGCGTAGGAAGCCTACCGTCCAGACGG
TTGAAAGCCGCAGGTCGTCGTGGGTTTGGCCGCCGCAGTGCTGCACAAACTGCTGACACAAGCACGCACTAGCAGAAACCTGCATGCTGCAGCATGCTGT
ATTGGTTGCACTGCATAATGATGCGACGAGCTCTCCGCGCAGCATTCTGCTACGCACTGCACTGCGTAGGCTGCATTACTATACGCAATATTCAATTGAT
TGTGTGCTGATAGTATAATGGGAACGCCTGAGGTTGGAGGATCTGAGGGCTGTGAGGGTGGGCTGGCGTCGTCCACTCCGAAGGACAAGTTAGGCAAGCC
GGTGGGTATAATGAAGATATGTATTAAAATATTAAGAAGGCTGTACAGGTCACAGTGTGCAATGACGCCGACGCCGCTGTCTTGGCGGAGTAGCCATCAC
GTGACTACCTAGACCCATTGAAAAAGCAAGCGCTGGATATGGTTCGGGTATCATTGGCGCCGTCGCCGTCTGCCAGTCAGCGCTAGACAAGTGGAGATGG
AGACATGAGCGTGGAAATGATAGATGAGTCTTTGGTTGATACATGAGTTTGTGGTTGTCGAGCAGAGTGGAAATGTACATGTCTTTCAAACTCGTTGACA
ACGGGAGACCGTTGCACTTGCGGTGGGCTTGGCCAATCAGGGTCCGGCCATGTGGTTTTGCCAAGCAAGCAAGTTCAGAGGCGCCTCATAATTCAAGCGG
CGGTACGTCGAGCGAGTGCGTCGAGTGTTTCCAGACCATAGCAGCATCGGACCCAATGACGGCAGCTGTCATGTTCGCGGGCGTGGACATCGGGGGAACG
GGCGTGAAGGTGGGCGTCGTCACGTCCGAGGGCTGTGTAGTGGCGCGCGAGCAGAAGAAGTACCACCCGGAGAAGCACGAGCCGCAGGACGTCGTGGATC
TTGCCGTCTCCGTGCTGCATCAAGTGCTCAAGACGGTGCGTGCGTCGAAGTTGATGGTAATTAGAGTGAGGTGTCTCACCAGTCGTCTACCTCATGCTGG
CAGACGCGATTGGGATTGGGGGACCTGGAGGCGGTGGGCGTCGGCTGCCCCGGCGTCCTGGAAGCTGGGGGCGTCATCCACGCAGCTGCCAACTTCCCGT
TCTGGTTGGATGTGCCGCTCCAGCAATTGTTCACCGACACCCTTGGCAGACCGGTTAGTGGGGGGTGTTTGGGTCTGTGGCTTGAGGAATGTTATGGTGC
TGACCGAAAGTGTAGGTTACTGTGTGCAACGACGCGGATGCTGCCATTTTGGCGGAGCAGTGGGTCGGCACAGCCAAGGGTGGCATCAAGGATTTTATCA
TGCTCAGTGCGTGAATGT