Description :
From Genome Similarity Track
Location :
Scaffold_17:319076- 321269
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007083Similar to Atp8a1: Probable phospholipid-transporting ATPase IA (Mus musculus)

Sequence
2193 bases(100 bases per row)
GAAAACTTGATCTTGCGCGGAAGTGAGAGTCGTAACGCCGAATGGACGATTGCGCTGGTGATCTACACGGGCAAGGAAACCAAGATTTCCATGAACTCGT
CCGATGTTCCTCTGAAGAGAAGCTTCGTGGAGAAGACGCTGGATACGATGTTTGTGCTCGTGTTGGTGCTGCTCTTTGGTATTTCCGTCGCGTGCACTCT
TGGTAACAACAACTGGAACTGGGATTTGGACGACGACAAGTCCCCGTGGTACATTGGCAAGAATGTGGAGAATGGATACATTTTTTTAAGTTACGTGATC
CTGTTCAACAACCTGATCCCGCTTTCGATGTACGTCACGATGGAAGGCGTGCGTTTCGTTCACGCTCGCTACATCGAGAACGATTTGGAGATGTACGACC
CGCATACAGACACACCCGCGCAAGTTCGAAACAGTAACATCAACGAAGACTTGGGGCAGATCCAGTATATTTTTTCGGATAAAACCGGAACGTTGACGCG
AAACGAGATGATTTTTGCCAAATGCACGATCGCTGGTCTCCGCTACAACGATATCGATATGGACTCTGTGAAACCTCCGCGACCTGGTACGCGCTTTAAC
GATTCGCGTTTGATTGGTCGTCTGAATGCAAATCACTCGACGAAGAAGGAGATTCACGATTTCATGCTGCTGCTGACGATTTGCAACACTGTGATCCCGG
AATACGACACTCCTGCTGCTGAGGCGAGCGGACTTTCGAGTGTGACCGGCAAAGTCAAGTACAATGCTTCGTCTCCCGATGAGCAGGCTTTGGTGTTAGC
TGCGAACGATTTGGGGTACGTTTTGACGGGGCGTGATGGCCCGATTTGCCATACGCTTATCCAAGGCGTGCCAATGTCGTTTGAGATCTTGAACGTTTTG
GAGTTCAACAGTGATCGTAAGCGAATGTCGATCATCTTCCGACACCCAGATGGAAGCATTATTTTGTACTGCAAGGGCGCAGATGATATCATTTTCGACT
TGCTGTCCAAGTCTCAGCCGCAAGGTGTCGCCCACGTGACGCGCGGCCATCTGCAAGAGTACGCATCAGAAGGGCTACGTACGTTGACGACAGCGATGCG
TCGTTTGACAAACGAGCAGTACGAAGAGTGGCATCAACTGTATCGTCAGGCCGAGTTGTCTCTTGACAACCGTGCTGCTAAGATTGCGAAGGTTTCGGCT
GTGATTGAAGTGGAATTGACGCTTTTGGGAGCGACGGCTATTGAAGATCGGTTGCAAGATGGCGTAGAAGAATGCATCACGTCGCTGCGAAAGGCTGGAA
TCAACTTCTGGGTTCTCACTGGTGACAAAAAAGAAACGGCGCTCAGTATTGGTATGTCGTCACACGTGATTGACGACAACATGGACGTAATTGTTCTGGG
ACAACGAGACAAAGCTTCGCTTCGTGCCAAACTAGAGGAGCTCTATGTTGATTTGGTCGACGACAAGTGGGGCTCGGATGAGCACTCGTCGGCTGTGAGC
GTGTTGTTCGAAGCCTTCAAGCGCGTGTTCTTGATGGGTTGGGATCTCGCAAAGACTGCTATCTTAGGTCGTGACGTGCAGGCTGAGGCCCGCAAGAAAC
GAAGACGCGCCCCAAGAAGAGACGAGCATGCTGGAGGCAACGACGTGACGCCAACGGACAGCCAAACCCAGTTTGACGAAGTGTACCCTGCTCTGAACAT
TGACGAGTCTGGTGTGAGTCAGGAGCACGGTCATTGTGATCGCCAGTTTGAGCCGAAGAGTGATTTGCAGAACGTGAGTGAGGAGTTTGTGGATGAAGAA
CTCGAGTTCGCGATGGTGATTGATGGCAAGACGTTGGCGTTGCTCCTCGAAGATGACATCAAGTACCTGTTTTTGTCGGTTGCGACACAGTGTAAGTCGG
TGATTTGCTGTCGTTGTTCGCCTGCGCAGAAGGCTTCAGTGGTGAAGCTGGTGACGGAGCCAACACTGATGTTTTCGCCGGGTAATATCACGCTGGCTAT
TGGTGACGGTGCGAATGATGTGCCTATGATTCAAGCGGCGAACGTCGGTATTGGCATCAGTGGAAAGGAAGGCAGACAAGCTGTGCTCTCGAGTGACTAT
TCGTTTGCAGAGTTCCGATTCCTGAAGCGTTTGCTGCTGGTCCACGGCAACTACAGTTACAAGCGTATCTCCAAGCTGATTCTCTTCTCGTTC