Description :
From Genome Similarity Track
Location :
Scaffold_1874:3190- 4961
Transcript NameFunction/comments
Phyag_g11659conserved hypothetical protein

Sequence
1771 bases(100 bases per row)
AATCGAAAGCACTTTTCATTTCGCTTTCAGTCAGCGTAGGCAGTATGAACCTCGAGGCTGGCACGGCGCAAAAGCGTCCTGAGGAATCTCGACCCAACCG
TCGACCATGGGCGTCTTGGCGTCTTGCGGTGGTAGGCATCGTAGGTGCCTTACTGGTTGTCACTCAATTCACCACCTACACACACCACTTCCATGCACAT
GTGGCCAAGCACCGCATTCTGCGCAACCTGCAGGAGCAACCGGCACTTCGTCTCACCTTCGAACTCAAGCGTAAAGCCATGTACGTTCATGGCGCCTCGA
ctttcgacgtcgtcgcgacACCCGCACCGAAGAGTTCGGCCGATGATAAAAGTATGGTATACAACGGCATGGCGTCGTTCGAGAAGGACGGCGACACACA
CGAGTACTCACTCGTGGACGGCACGACGTACTACACCCGTCGTCCGAATGGTAACCCCGTATCGGAGACAACCGAGTCGGGGTGTCTGCCGTCGGGTTCC
GTGCCACCTATCCAGAGTGTGTTGAACGCAATTCAAGGTGCGGCCACTTCCAGTCAGACGAGTGACAAGTGTCCCGGTGGTTCGGTGATGGTCTTCCAGT
TCGCCGGTGAAGATTTCGTGCTATGCTCGCGTCAATCGAGCTTGTCGTGGCTCCAGGACGATGGGTTCCAGATCTTCGGTAAGGACCTAAACATCGGCGT
CAAGTACGAACAGACTGCTCCGGTTATTGTTGCTCCGCGTGTGCCGACAGCGGAATTGGCTTCGTGTGGCAAGGTTCCTTTTGGTGAGCGGGTTACTCcc
tcgctgccgtcgttgtTGAGTCGGTCGTTCTCGGAGTGGGGTCACCGTTCTCTGCGTGAAGAAGGGTTTTTTGGCAAAGTTTGGGACCTCGTCACGGACA
ACTCTTGCGGCTGCAAGGGTGCTCAACGCACTTGTGTGTTTATTGCGGGGTTGAGTTCGTTTGAGGATCATGGACTGACAGACGACGACCCGGAAGGATA
CTTTGGAGACGAGATTGGAGACCACTCGccttgctgctcgagcaggaaGTTCATCACGTTGGCGACCAAGGACAACTCGTGGAATGATCCGAAGTTTCAG
GATCGACTGGTGGATCTACTTGTTCAAGCGAGCGGCACAAGTGACCCAGCTACAAAAACTATCAAGGACACTATCATTATCGCGCACTCGATGGGGAACC
TCATCTTGGCCGGAGCCATTGCAGATACCAAGGCTACTCTTGatccgtcgacgtcgtgggTGGCGCTTAGCAGCCCCATGGAAGGCAGCATGGGCTCCAA
CTACATCCAGGAATCATGCAACGGACAGCAAACTGGTTTTGTCGCTAGCATCATTGAGCTATTGGGCGATTGCCCTGCCAACACGGGGGAGACGTCACTC
GCGTACCAGGGCTCCAATTTCTCGTCACAGTCGCTGAACGACGCCTATGTTGCCGCCCAAAAGGCCTACGCTGCTAACGTAGACGCGGTCATGTGCAGTA
ACAGCTTCACGGGTttggtgacgatgaaagCAGCGATCTACGCGCTGGCAGGTAAAATTCTACCCCACCACTCTTCCGAGAACGATGGGATCGTGGAGTA
CTCAAGTTGCGCGATGGGACTTCCACTTGACAGCTTCGACAATTCGTACAAGAGTCCGCGCTACGTGGCCGAGCTCAACCACGTGGACACGTCGTTCCGG
AACGGCGATGGTGTCTTcagcgacgccaagaagcctTTGAAGTGGTTTGAGTGCCTTTTGTAGGTGGTGGT