Description :
From Genome Similarity Track
Location :
Scaffold_2895:319- 4015
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap-piw_contig_2895-abinit-gene-0.10Nucleolar protein
Pytiw_DAOMBR242034maker-piw_contig_2895-fgenesh-gene-0.230S ribosomal protein S16

Sequence
3696 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGAGGAAGAGGGCGTAGACGAGGACG
GGCGCAAGAAGAGCCACAAGGAGATCATGCAGGAGGTCATGATGAAGGCCAAGATGTACAAGGCCGAGCGCCAAAAGAACAAGTCGGCCCAGGAGGAGTC
CACGGACAACCTCGACGAGGGCTTCAACGACATCCGCGGGCTGCTCGAGTTCCGTCCAACGCGCGCGAACGGCAAGGAGGTCGTGGAAAAGGCGCCCATG
GACGACTTTGACAAGCTTACGCGCGAGTTCGCGTACGAGGCCAAGGTCAAGGCCACGGAGCGCCGCATGTCCCCCGAGGAGGCCGCGCAGAAAGAGCGTG
ACCGCCTTGCCGAGCTTGAGAAGAAGCGCGTGGCGCGCATGAAGGGCGACGATGCCGACGACGACAGCGACGACGAGGCCACCGGCGGCAAGCGCGGCAG
GAAGGGCAAGAAGGCCAAGAAGGCCGCGGCGGACAAGAAGAAAAAAACCCCGCAGCTCATCATAATGCCACCCACGGACGACGACCTCTCAAGCGACTAC
GCGCTCGACGCGCGCTTTAACGGCGGAGCGGAAGAAGAGGAAGTCGATGAGGATGACGAGATGGAGAGAGACGAAGATGAAGAGGAGGGCGATGATGATG
ATGAAGAAGAAGACTCGGAAGCTGAGGACTCGGACGACGATGGCGAGAAGCAGGACGATGAAGAAGAAGAAGTCGATGCTGCGATGGAAGAAGAAGACGC
TGAAGAAGCTGAATCTGAAGAGGAGGGCGAAGAAGAAAAGGCGCGCAAGCGCCAGGAGGCGGCGGACGAGCTGCCGTTCGTGTTCCCGTGTCCCGAGAGT
CCCGAGGAGCTCACGGCGCTCTTCCGCAAGCACGCCAAGGCGTCGGCCGTCAAGCGCGCGCTCATCATCGAGCGCGTCATTACGTACTACTCGCCGCGCA
TCAGCGTGGAGAACCAGGCCAAGATGAAGAGCTTCTTCGCGATCCTCATCCGCCAGTTCCTCAAGTGGGCCGGCCAGTACGCGATCCACCGCGAAGATGT
ACGTATTGCAACGAGGTTGTTGATTCTCGCCTCATTCTGAGCCGTGGCGACAGGCAAACTGACCTTCTCTGTACTTTACCCCCTCTCTGTGTGAACAGCT
CAACGCCCTGGCCACCCATTTGTACGCGCTCGCGCAGCAATTGAGCGATACGGCCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCAACCTGTTCAAGCGCCTGCACAGCTCCAAGTCGCCGTCCAAG
TGGCCCGAGCTGTCCGAGCTACTGCTCTTCCGAGCGCTCATCCAGATCTTCCCGACATCCGACCTGCGCCACAATGTAATCTCGCCGCTCGAGACGCTGC
TGGGCGAGAGCCTGGCCAACGGTGGCCTGGACACGCGCCAGGAGGCCACGCAGGCGCTCTTCACGTGCACGCTCATGCTGCAGATCACGCGCGAGAAGAA
GCGCTTCACGCCCGAGGTGCTCGTGTGTCTCAAGAAGCTGCTGCGCGCGTTTGTGAGCTCGAACGGCGGCGAGCCGCACGCGCTGCGCTCCGACCTGCAG
GAGTGGGTGGCTGGCAGCAGTGAGCTAAGGCTCCCGAGCCTAGAGCTTGCGACCGCGTCCTCGGCGTCCGCGGCGTCCATCGTGAGCGGCCTGCTGGGCG
TCGTGCAGCTCGCGGCCGACCAATATGCGCAACTGGCGTCCTTCGACGAGCTCTTCCACCCTGTGTACCTGCTGCTCCACGAGCTCACGCGGTCGTTCTT
CGGCGGCAAGAGCAGCGACGTGAACGCTGTGATCGCGTCCGTGGCTGACCAGCTGGAGAGCTGCTGGGCGGCGCGCACGCCACTGCGGCTGCAGAGCTTC
GCACCGGCGCTACTGCCGACGTTCACGCCCAAGTTCGACGAGAACTACACGCTGCGCAAGGACAAGGGCGCGGACCGCGACAAGGCCAAGCTCAAGCAGC
TCAAGCGTCAAGTGAAGCGCGCGCGCAAGGGCGCGGCCCGCGAGCTGCGCCGCGACTCGGAGTTCCTCGCGCGCGAGAAGCAGACCGAGGAGACTGCGCG
CGTGGACGCCAAGAAGGAGAAGCAGAAGGAGATCTGGAAGTGGCTCGAGGAGCAGAACGCGACGTTCAACGAGCAGGTCAAGAAGGGCGGCAACATGCTC
AAGGGCGGCGGCTCCGGCCCGCTCAAGAACCGGCGAACGAGCAAGAAGGATAGATAGACAGACAGGGATTCGTAGATTCGTAGAGCTAGCTACCTGCACG
AGAGTGAGGCCACGACGGATGGATTGAATGATTGAATGAAAGCAAGAGATTGTATAGATGGCGACGCTCGCATTGGATGCTGATGGCTAGATAGTGAGAT
ACACAGCCAGTCAAGCGCGTGCTGATGCAAAGAAGCGTGTGTTAGGTCCTCATGTTTGTCTTTGTATTGTTCTCTTCCAGCCAGTCTGTGCCACACAGGC
GCAATGCATGGCTCTTTGCGTGGCGTTGGCCCCGTTTCGTCGCCTTGTGTTCTCCTGTGCGCTTGAACGCCTGGCCGCACCTGTGCACCTGTGCGTGTGT
TGTTTTCCTATCCATGCGCTCCTGTATGCTGCGTTCGCTGCTGTCTACTTCTTGACTGGCGCGCGGTCCTTCTTCGGGATGCTCTTGACGCCGTACTGGC
GCGTAGGCGGCATGGGGAGGATGTTGGCGATGCCCAACAGGTGGCTCACGCGGTCCGACGGCTGCGCGCCCACCGACACCCAATACCGCACGCGCTCACT
GTTCACGCGCAGCTCCTTCACGCCATCGGTCGCCGCGATCGGGTTGAACGTGCCCAGCTGCATTCCATTCATCCATCCATCCCATACATGTTCATTAGCG
TTAAGTTCCGCATAGAGAGCGTGTCGTCACGCCATTAAGAGTGCAAACCGTACGATCTCGAGGTGCTTGCCGTCGCGAGGGGCGCGCGCGTCCGCAGCCA
CGATGCGGTAGAACGGGAGGTCCTTGCGGCCCCAGCGCGCGAGTCGCAGTCTCACCACCATCGTCACTGCCTGCTTGCTTGTGTGGCTCGGTTGGAAGAC
GCTGTCTGTCTGTGTATGTGGTGGCTGGCTTTGGCAGGTTCTGGCCTTTTTCGTAATTAAAGGAAATCATGACATAGCATAAGTACGATTGGAGCTCCGG
ACTTAGCGCCTGACAGCCTGGCATTGCAATTGGCTACTTCGCCTTAAATTGATTAAGATAACGTGGAGATTATGTAAAATAGGACAAACTTAGCGAGAGC
AGCTTGTTTAGGACAATATATTTAGGACAGACTAGTTGGTGTCCTAGCCCTGAACGTCCTAAACTGACGTTTGCTTTCTCTGAATTTCAAGAAACT