Description :
From Genome Similarity Track
Location :
Scaffold_2192:319- 2399
Transcript NameFunction/comments
Phyag_g12178hypothetical protein PHYSODRAFT_475141

Sequence
2080 bases(100 bases per row)
TCAGATATCGGCGCGGGTAACGAGTGTTCGTGGCTGCCAAGAGCTCTGCATCGTGGCGGAGGAGCTCATGAGACCTTCGCCCGATCGCGCCACTGCGGTC
GCAATCGGCGGCAGAAGGATCGACGGAAGAGTTGTCGTCTCCACAGGTTCCGCCTTGGGAGGGGTCAATGGACTGCGGTGGCGCAACCACGCACGCGTCT
CCAGTGCCGGCTCCATCTTGGCCAACGCCGCCACTCGGAGCATGGCACGCGGACTCCTCGGGTACGACGCGTTCATCCACGTCGTTGTGGGCACTCTGCT
GGCCTCGCGCCACGAGTCCATCTCGTTGGCGTAGGCTGGAGATCCACTGTGCATAGCCACAAGTCCTGCAGCCCTTTGCAGCTCTACGAGGGTCGGGGAG
GCGCGCGGGGCTCGGATGTACTGCGTCGTTAGGGGTACGGCattcagctcctgctccagcttgagtGCGATTGACGCACGCATGCGCATCCGACGCTCCA
GGtccgagaagctgctgtgcaACGGCAGATGGTTGGGCAATCCGAGCGCGGCTTGGCCggctttgcgcttcttgtccagccgacgctggttgctgttggc
CTTCTGACGGTGCATCTCGCACAAGTTGTGGCGCTCCCCGTTGCGCTTGATGGCGCGCAGGTTCCAGCAACGCTTGCTGGCGTAGCGGCACTTGAGCGAG
CtgaactcgtcgtccgtggTCTGCATCTTGtgaagaatgaagaagatgaagaaggagaggcTTTGTCCGGAGATGacaaattgaaaagtgagaATGCACC
TGTATATGCCGTTGCCGCAGCGGATAGCAAAGCGTCTTCAAGGTGCAAATCTTAGCCAAAACTGAGATGTCGACTTAAGGGCGCAATGGTGACTTAGCAA
CCGCAGCGCCATTTTTCGAAGCATACAAATGTCAAGATAAACGTTGACTTAGGGGTgaggagacgctgcgagTGTCGACTTAGCTGGAGAGGAGTGTCGC
TTTTTGGTGGGGCCGGCTGGAGaggagacgctcaagatgaTTTATGGTCGGCGAGTGCGCGGCCTTCGCAAGCTTGCAGTAAGCTCCGGACCGATGCAAG
ATAATAGCTCGGAAGGTTTCCATGCCAGATCGTCATGAGTATCGACAGCAAAAGCGCCGCTCCCATGGACGACCAAGACGTTGTGCGTCGTAGTGGCGTG
GCAAAAGACAGAGTACCCTTCTCGTTTCTCGACATGGGTACTCTGCCATTCAACCGTTGTTGCTGATTTTTTAGTGCGAATCAGTTTGGCTGAAGCAACC
CGTGCCTGAGCGATGGTGGAGCGATCTCGAGCAACATTTGGGCGCCGTGCAAGCAACACGGCCCCTTGTCCCTTGTTTGTCATGGTCACGCTCGGCGCGT
TATTCGCAGTCGCCCGGGCTCAGGGctcatctgctgcttccagctgaagctgcggcgaGAGAGCGCCGAAAACTGGACTCTCAGCTggagcaagcagcaa
acgaTCTCGGTGCCCGATCTACACATCctggccgacgacgagaatAAGTCAAGCCCGCCCAGAGATGGAAGATATCTCTGACAGAAACCAGTGGCTTGCA
CGGCTCGTGGCGTATGGGTGGGCTCGTAATCTGCCACGGCAAACCAGCACGATCAGTTTGTGCCTATACTTGCGCCAGCGTGGTGGTGTGCCTTTCATCG
TGCTTTTATCGATGTAGTGCAGTGCTGTCGCTCGGCGCCGGAGCTGTAATGGAGTTGCACACAAGCATAACATGCTGACTCATGTGTTGTTGTGTGACAA
CAAAAAATTGAAGTGGCGAGCCACTGTCACCTTGATGATCTCGAACCGTACGGCAAAGGCGAGTTGAGGATCACTTGGACCGTGCAACCGCTACACACCG
GACAGGTCAGCTTGTTTTATGATTCAGCAGGTCGTTGTCTTAGCGTGCCCTCCGGATGGTGAGCGCGTCTAACACGTCGTGACGCTTTCGATCACGTTGT
AGGCGCTGGAGGGAGCCGGCGTAATGCAATGGCTGTGGTCTCGCGCCGCAACGCTGGAGTTAGTTATCTCCATTCTACAC