Description :
From Genome Similarity Track
Location :
Scaffold_4129:319- 1321
Sequence
1002 bases(100 bases per row)
CGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCTCAGAATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTA
TGGCCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAACTTATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCA
ATCCAAACGGCATCCGGGTCCATTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTCACCACCCCGAAACCACT
GGCCATGTCAAGAGAACAGTACCAGAGTAATTTATCCAAATCTTCCAATAGCGCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTA
ACCAGCCGGTAATCGATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTTGAGAAGCCGATGATCT
TGGCTTGCAGCAGGCCCTTAATCAGATCCGACCGTTTCTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGTGTCGCCGACATC
GATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCTTTACCGATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGTAGACGATCCACT
TCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCAA
GATCTTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCAGTCTTTGTCAGATCCACCCTTGGATCCAGGCACCGCGACTCCCCTTC
GACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAACCACCTTTTGGATCGACTTGATCCTCTGGTGGGTTTACCCACGATGGT
TC