Description :
From Genome Similarity Track
Location :
Scaffold_4:318996- 320401
Sequence
1405 bases(100 bases per row)
GCGCGTTGGAGGAGAAATCCGATGTGAAGACACCGGCCGCTCAATCTCCCACGACAACGACGCCACCGGCACCACGTTCCACACCACGAAGATCTCGTCG
CTCACGCCGCAAGTCGTGCCGCCGTGCTGAAGCTGAAGGAGACGTGGAGGTTGACGAGTCGAGGCTGAACACTGAACCTGTGGCTTTGACCGTATCCGAA
GTTGAGGATGTCAATTCCCACGCTGATGACCCGGAACCGAAGAACTACAGGCAGGCGCGGAAGTACGCCGAGAGCGCGCTTTGGGGGGCAGCTGAAAAGG
AAGAACTTGAAGCTCTCCAGGCGAATAACACGTGGAAGCTGGTCAAGTCCGAGCCTGGAAGCATTCGCTTGCATACTAAGTGGGTGTACAAGAAGAAACG
AACAGGCACGGGTTTGATCGAGCGGTACAAGGCTCGACTAGTCGCCTGTGACAACGAGCAAAAGTCCGGCGTTAACTTCTTTCTCGTGTTTGCGGCTGTG
ATTACCATGACTGGTGTCAAGTTCATCTTCGTCATGGCGATCATATGGAAGGTACCTGCCAGACACAGCGACGTTCTAAACGCGTATGTAAAGGCGAAAA
CGGAGGAGGGATATCGAGATTTTGCTGCTCGTCCCCGACGGACTCGTTATCACGGAGGAAGAGCTGAAGACGCTCGGAGCTGAGAGCGTGGATGAAGTTG
GCCTACTTCTTGGTCAGAGCCTTTGCGGTCTGAAACAAGCAGGACGCCTTTGGCATGAGCACCTTCATCGCGAACTGGTCAAGCTTGGGTTCATCCAGGG
CATTACGGACGCGTGTCGGTACTTCAAGGCTGACAGCGGCGGAAAACGGTCGTCGGAACGTACGTGGATGACCTGCTGGTTACTGGCACGGACGAGAACA
GGGTTTACCAGTTCTTCGCTGACATATCCGTCCTGGAGCTCAAGGATCTCGATGTTGCCAGTAATTTTCTTGGTATGCGCGTGCAGTACGATGAGCTCAG
TGGTTACAGGTTTGACCATGAGGCTGTAATCGTCGAGATGCTCATCAAGTTTGGATTGGACAAAGCAAATTCGGTGCAATCGCCGATCGGAGGAGAAGAC
GCGGCAGAGTCAGATTTGGCAGAACTACTTCCGCACACGGCAAAGGAGACCGCGTCAGCAGGGCCGACGGTGACAAATTTCCAGTCACTGGTGGGGAGTT
TGCTATGGATTGCGAGATGCACACGTCCTGACATTATGTTCGCTGCACACTGTGCAACGCGACGGGCTCATACGCCAACGATGGCGGATTGGAAGCTGGC
TAAGCGCATCGCCAGGTACCTGAGTGGCACCCGATCGCACAAGATGGAAATGTCTGGCGACGATACTGCTAAAAGGCTACCACTACGATTGCGCTCGTAT
ACGGA