Description :
From Genome Similarity Track
Location :
contig_42:318972- 320374
Transcript NameFunction/comments
g9523.t1OWZ13885.1 hypothetical protein PHMEG_00012721 [Phytophthora megakarya

Sequence
1402 bases(100 bases per row)
AATGACTGTGAACTCGGGCGACGACACGACTTGCAGCACGCGGTACAGCTGCGTGTGCGCCTGGCGGCTCGTGTACGCGGTGAAGTTGTCGTCTTGGTCG
ATGGCGCAGCGCTCGACAACGTACGTCTGGAGGACGTGCTTCGTGAGTCGCTGCGCCTTGTTGGCGCCGCTTTCCCAGTCGTAGTACCAGCGCGAGAAAG
GCTTGCCGTTGAGGTGGAACACGAGCGGTTTCCGGTCGTCTGCCGGCATGCCCGGCGTGCGGATGGTGGTCACGAGTCCGGACGGCCGATCGAGTGCGCC
TGCCACCCACTGCCCCTCGAGGTTGTTGTCGGACTGCGTGCCGGCCGCCATCTTGTCCACCTGGACGCACTCACCCGGTCGGAGACTCACGTCGTTCACG
GCCTCGAAGCGCGCAAAGACGGCCAGGATCTCGCTCGGCGGAGGGTCCGTCGGCGCGGCATCGGGAGACCGGATCCCCAGCTGCACGCGCACACTCAGCG
ACGTGCCGCAGTAGCTGCGGTCGATGTGGTCAGGGCAACAGTGCGGGAAGCACCTGCAACACGACCACAATGGGCAAAAGGACGCACCACCAGAGCCACG
TGAGCGGAATGGACTTGCAGTCAGCGGACGGACTCATTGAGAAGAGTCCCAAATGGTCCGTTTCTTACCGAAGAATCTTGAGGCCTTTGGTGCGGTTGCT
CCTGCAGAACAGCAGCAAAGAGGCAACACGGACGTATGGGAAGTGAGCGACGGCGGCTTTTTTTTTTTTCTATGAGTGGCTTAGGTTTTAGGCTCTAGTA
AAAAAAAAAAAGAATACTATTGTACTGGCCAAAATAGTTGATACCAGGAATTGTAACACGAGCACATTTGCTGTCATTGCTCATCTAATATTAGACGTAT
GGGGGTGTAACGACCCGCAAAATGATGCAGGGCGTCAGCGCTAGCGACTGCAGTTAGTTTTATACGCTCCCATCCACAAGAAGAATGGTAAGAGGTAAAC
GACTAAGTGATGCTGAGCGGGATATGATCGTGAACGCGTACAAATTCTTCAAAAATCAGCGGCAAGGAGAACCCGAGGCGTCAGGGCGAACGCGCAGAAT
GGTTTACCAGTGTATTGGGACACCAGAGGCCACAGTAGGACGCGTCTGGAAGGCGTATCAGGACCGCGAAAGCTCTCGACCTGCGGAGGTTCGTGTGATT
TACTTACCTTAACGATACATATCAATAACCTGTAATAAAATAATGCAGGCACCGGTCGAGGAGAGTCGAGGGCGCCCACGGAGCTATGAACCCGAAGACG
TCTCGCCCGCCATCAACGCGTACATTGAAAAGTGCAATAAGGAACGACAGCCCATTACTGCACAAATGATTAGTGATGAAGTTCTTCGGTGCACGACTAT
TA